بررسی ارتباط چهار پلی مورفیسم در ژن TNP2 با روند اسپرماتوژنز و ایجاد ناباروری مردان

نوع مقاله: مقاله پژوهشی

نویسندگان

1 گروه میکروبیولوژی،دانشکده علوم زیستی، دانشگاه آزاد اسلامی ،واحد تهران شمال، تهران، ایران

2 گروه ژنتیک پزشکی، پژوهشگاه ملی مهندسی ژنتیک و زیست فناوری ،تهران ، ایران

3 گروه ژنتیک مولکولی، دانشگاه تربیت مدرس، تهران، ایران.

چکیده

در اسپرماتوژنز انسان، پروتامین­ها به عنوان پروتئین­های متصل شونده به DNA اسپرم جایگزین هیستون­ها می شوند. برای تمایز و بلوغ اسپرم جایگزینی هیستون­ها با پروتامین­ها ضروری است. آسیب در ژن­های کد کننده پروتامین­ها
می­تواند منجر به تخریب اسپرماتوژنز و عدم تشکیل اسپرم کامل شده و در نتیجه سبب ناباروری مردان گردد. در این تحقیق به بررسی حضور چهار پلی مورفیسم در ژن TNP2 از ژن­های خانواده پروتامین­ها و ارتباط آن با ایجاد ناباروری ادیوپاتیک در مردان ازواسپرمی و الیگواسپرمی ایرانی پرداخته شده است. حضور چهار پلی­مورفیسم T1019G،G1272C، G deletion at 1036 and 1046در ژن TNP2، پس از استخراج DNA از نمونه خون 96 مرد ازواسپرم و اولیگو اسپرم با ناباروری ادیوپاتیک و 100 نفر گروه کنترل با روش PCR-RFLP و PCR-SSCP بررسی شد و سپس با روش Sequencing نتایج تایید شد.فراوانی ژنوتایپ CC از پلی­مورفیسم G1272C بین گروه بیمار و کنترل تفاوت نشان داد ولی با آنالیز آماری اختلاف معنی­دار بین حضور این پلی­مورفیسم در مقایسه گروه بیمار با کنترل مشاهده نشد (P>0/05). همچنین پلی مورفیسم­های T1019G و  G deletion at 1036 and 1046در هیچ یک از گروه بیمار و کنترل مشاهده نشد. مقایسه نتایج این تحقیق با مطالعات انجام شده در این زمینه نشان داد که بین حضور این چهار پلی­مورفیسم بررسی شده در ایجاد ازواسپرمی و اولیگواسپرمی با ناباروری ادیوپاتیک در جمعیت مردان ایرانی ارتباط معنی­داری وجود ندارد.
 

کلیدواژه‌ها


عنوان مقاله [English]

Study on association of four polymorphisms in TNP2 gene with spermatogenesis and causes of male infertility

نویسندگان [English]

  • elham siasi 1
  • Ahmad Aleyasin 2
  • Javad Mowla 3
1 Department of Microbiology, Faculty of science, North Tehran Branch, Islamic Azad University, Tehran, Iran.
2 Medical genetic department, National Institute for Genetic Engineering and Biotechnology, Tehran, Iran.
3 Molecular Genetic Department, Tarbiat Modares University, Tehran, Iran.
چکیده [English]

Protamines are DNA-binding proteins in the sperm nucleus, which cause differentiation of human spermatogenesis. Protamines required for packaging nucleus sperm by replacement of histones with protamines. Sperm protamine deficiency has been associated with spermatogenesis failed and caused male infertility.  In this study association of four SNPs in TNP2 gene were studied in Iranian idiopathic infertile men with azoospermia or oligospermia. Analysis of four SNPs include T1019G, G1272C،  G deletion at 1036 and 1046 in TNP2 gene  was performed by DNA extraction from blood samples of 96 idiopathic infertile men with azoospermia or oligospermia and 100 normal control men. Then using restriction fragment length polymorphism (PCR-RFLP) for detection of T1019G and G1272C, SNPs and for identification of G deletion at 1036 and 1046 used Single Strand Conformation Polymorphism (PCR- SSCP). Results were confirmed by DNA sequencing analysis. For (G1272C) in TNP2 gene, frequency of CC genotype was differented in fertile and infertile groups but statistical analysis showed no significant association related to this SNP in case and control groups. As also no polymorphisms were found for T1019G and G deletion at 1036 and 1046 nt. These results are consistent with previous studies and indicating that four tested SNPs was not associated with oligospermia and azospermia and idiopatic male infertility in Iranian population.

کلیدواژه‌ها [English]

  • Male infertility
  • PCR-RFLP
  • PCR-SSCP
  • SNP
  • TNP2 gene

ناباروری از دیدگاه کلینیکی به مفهوم ناتوانی در بارداری بعد از 12 ماه آمیزش طبیعی بدون استفاده از وسائل جلوگیری کننده از بارداری می‌باشد. تقریبا از هر شش زوج یک زوج به این مشکل دچار هستند که در حدود 50 درصد از موارد به دلیل ناباروری در مردان[1] است[3]. برآوردها نشان می‌دهد که نیمی از موارد ناباروری به طور کامل و یا تا حدود زیادی به دلیل ناهنجاری و اختلال در اسپرم است که باعث می‌شود ناباروری مردان به عنوان یکی از شایع‌ترین علل ناباروری در نظر گرفته شود [3].

ناحیه تعیین جنسیت در کرموزوم Y(SRY)[2] در بازوی کوتاه این کروموزوم (Yp) قرار دارد، در حالیکه ژن‌های کنترل کننده اسپرماتوژنز در قسمت میانی بازوی بلند (Yq) قرار دارند. چرخه 70 روزه اسپرماتوژنز بوسیله سلول‌های سرتولی در تبول‌های اسپرم بر[3] تغذیه می‌شود. در میان سلول‌های سرتولی، سلول‌های اسپرماتوگنی قرار دارند که طی تقسیم میتوز به اسپرماتوسیت‌ها و سپس طی تقسیم میوز به اسپرماتیدهای گرد هاپلوئید تبدیل می‌شوند. اسپرماتیدهای گرد، طویل شده و سپس به اسپرماتوزوآی دارای فلاژلتبدیل شده و تمایز پیدا می‌کند. اسپرماتوزوآ در طی یک دوره 14-2 روزه ضمن عبور از اپیدیدیم، محلی که در آن پتانسیل بارورسازی را پیدا می‌کند، بطور کامل بالغ می‌شود. کنترل هورمونی بر فرآیند اسپرماتوژنز بوسیله هیپوتالاموس و غده هیپوفیز و از طریق آزادسازی هورمون GnRH و به­دنبال آن آزادسازی FSH[4]و LH[5]هماهنگ می‌شود. به علاوه میزان محلی تستوسترون که بوسیله سلول‌های لایدیگ تولید و ترشح می‌شود، 100 برابر بیشتر از میزان آن در سرم است [3].

اسپرماتوژنز یک فرآیند پیچیده می‌باشد که تحت تاثیر ژن‌های زیادی قرار دارد و مکانیسم‌های مولکولی دخیل در حال مطالعه می‌باشند[11]. بنا بر تخمین‌های موجود در حدود 2000 ژن این فرآیند را کنترل می‌نمایند که بیشتر آنها بر روی کروموزوم‌های آتوزوم قرار دارند و در حدود 30 ژن نیز روی کرموزوم yواقع شده‌اند. در حالیکه ژن‌های آتوزومی با تنظیم فرآیندهای متابولیک در سایر سلول‌های بدن نیز ارتباط دارند [11 و 2]. از مهمترین عوامل ناباروری می‌توان به اختلال در تعداد، حرکت و مورفولوژی اسپرم و اختلالات ساختمانی، عدم تعادل هورمونی و عوامل ژنتیکی که درایجاد ناباروری مردان دخالت دارند، اشاره نمود ]11 و 21 و 24]. عوامل ژنتیکی موثر در ناباروری مردان که تا به امروز مشخص شده‌اند عبارتند از: اختلالات کرموزومی، بیماری­های تک ژنی، اختلال در میوز و اندوکرین[11 و 17 و 24].

علی رغم تمام عوامل ذکر شده، 25% از مردان نابارور دارای آنالیز اسپرم غیر طبیعی هستند که هیچ اتیولوژی برای آنها شناسایی نشده است [4 و 11[. این حالت را بنام ناباروری ادیوپاتیک مردان می‌نامند، که با دلایل ژنتیکی متعددی مشخص می‌شوند ]17 و 18 و 19[. پارامترهای اسپرم در 39% از این بیماران دامنه وسیعی از اختلالات را نشان می‌دهد و در حدود 2% از بیماران یک اولیگواسپرمی ادیوپاتیک عنوان می‌شود. نقایص در حرکت و فعالیت اسپرم در 24% ازبیماران وجود دارد و در 10% از بیماران اختلالات ساختمانی اسپرم مشاهده می‌شود. تاریخچه پزشکی و معاینه فیزیکی و آزمایشات هورمونی در بیماران معمولا نرمال است و گاهی فقط افزایش خفیف هورمون FSH مشاهده می‌شود که دلیل اختلال در اسپرماتوژنز نمی‌باشد [4 و 11]. از شایع‌ترین عوامل ادیو پاتیک، اختلالات در هسته سلول اسپرم و تغییر ساختمان DNA آن می‌باشد [16 و 23].

در اسپرماتیدهای تمام گونه‌ها، هیستون­ها
پروتئین­های کروموزومال اصلی هستند. هیستون­ها دارای توده کلی برابر با DNA در یوکاریوت‌ها هستند و پنج نوع اصلی دارند: H1,H2a,H2b,H3,H4.علاوه بر این پنج هیستون سوماتیک، بعضی از پستانداران دارای هیستون مخصوص بیضه‌ای نیز هستند (Testis specific Histones) [11 و 16]. همچنین پروتامین­ها به عنوان جایگزین هیستون­ها در مراحل تکوین هسته اسپرم ایفاینقش می‌نمایند و نشان داده شده است که ژن‌هایروی بازوی بلند کروموزوم 16 نقشی اساسی در این فرآیند جانشینی دارند ووجود برخی پلی‌مورفیسم و جهش درآن­ها
می­تواند با ناباروری مردان ارتباط داشته باشد [5 و 9 و 20]. در واقع لوکوس مولتی ژنی در ناحیه‌ای به طول 28 کیلو باز روی کروموزوم 16 درروند اسپرماتوژنز با ایجاد آزواسپرمی و اولیگواسپرمی در مردان دخالت دارد [5 و 9 و 20]. مهمترین نقش پروتامین­ها متراکم نمودن کروماتین‌ها در هسته سر اسپرم می‌باشد که این افزایش تراکم کروماتین‌ها عامل ناباروری مردان می‌گردد [6 و 15 و 20].  این ژن ها در ناحیه­ایی به طول 28 کیلو باز روی بازوی بلند کروموزوم 16بصورت یک لوکوس مولتی ژنیک که به صورت هماهنگ و متوالی بیان می‌شوند، قرار گرفتند. این ژن­ها پروتئین­های اختصاصی اسپرم (پروتامین­ها) را تولید می‌نمایند. پروتامین­ها از اصلی‌ترین و
کوچک­ترین پروتئین­های هسته اسپرم هستند که بین گونه‌های مختلف دارای ساختمان ثابت می‌باشند ] 9 و 12 و 22[. این پروتئین­ها غنی ازاسید آمینه‌های آرژنین و سیستئین هستند، که برای تشکیل باندهای DNA و پل­های دی سولفیدی در هسته اسپرم مورد نیازند.

کلاساول از پروتامین­ها، PRM پروتئین­ها
می­باشند و کلاس دوم از پروتئین­های پروتامین اصطلاحاپروتئین­هایگذرایاTP(Transition proteins)نام دارند که کاملا جانشین هیستون­ها می­گردند. در پستانداران دو نوع اصلی دارند: TP1, TP2 وجود دارند [6 و 15 و 16]. این پروتئین­ها با DNA تشکیل نوکلئوزوم نمی‌دهند و باید ابتدا نوکلئوزوم‌ها و هسته هیستون از حالت ترکیب بیرون آیند. در اسپرماتید متراکم و بالغ، پروتئین­های پروتامین، جایگزین پروتئین­های گذرا شده و با DNA ژنومی همراه می‌شوند. ترکیب پروتامین و DNA که بسیار متراکم و ثابت می‌باشند، بوسیله باندهای دی سولفیدی بین پروتامین‌ها ثبات بیشتری پیدا می‌کند [5 و 6 و 15 و 16]. این ساختمان بسیار متراکم و دارای زنجیره‌های جانبی نسبت به بسیاری از آسیب‌های خارجی که باعث نابودی بسته‌های DNA در حال میتوز می‌شوند، نفوذ ناپذیر است. بدین ترتیب هسته اسپرم در برابر اولتراسوند، هضم تریپسین، هضم آنزیمی DNase، مواد شوینده و درمان با داروهای خاص که باعث حل شدن اجزای سلولی می‌شوند، مقاوم شده و ثبوت خود را حفظ می‌کند. DNA ژنومی به میزان زیادی در اسپرم بالغ فشرده شده است و این درهم رفتن و
بسته­بندی DNA به کمک ماتریکس هسته و پروتامین‌ها انجام می‌گیرد [11 و 16]. علاوه بر این کمپلکس پروتامین-DNA، یک رشته DNA با شکاف بزرگ­تر به رشته مجاور اتصال می‌یابد، بطوریکه رشته‌های DNA درون هسته اسپرم به صورت ردیف خطی و پهلو به پهلو بسته­بندی می‌شوند. بر همین اساس کروماتین به وسیله باند‌های کووالان دی سولفیدی هم در درون و هم در بین رشته‌های DNA محکم و ثابت می‌شود. مسئله اساسی بروز فعال ژن هنگام در هم رفتن و فشرده شدن DNA هسته اسپرم است. تغییرات مورفولوژیک درطی اسپرمیوژنز و تغییرات در پروتئین­های پایه‌ای کروموزومال، پروسه‌های پیچیده­ایی هستند که شامل بروز صدها ژن در زمان‌های گوناگون می‌شوند. هم در نسخه برداری و هم در ترجمه درون اسپرم عمل کنترل ژنی وجود دارد، در مورد تمامی ژن‌های پروتامین، بلافاصله پس از میوز نسخه­برداری می‌شوند. همچنین یک هفته بعد نیز هنگام تجمع بصورت DNA ژنومی ترجمه می‌شوند. از آنجا که همانند سازی DNA و یا نسخه برداری RNA در اسپرماتیدهای بالغ و متراکم صورت نمی‌گیرد این اعمال باید در مراحل اولیه اسپرمیوژنز برای تولید پروتئین‌های پروتامین­ها که در مراحل بعدی برای بسته­بندی DNA مورد نیاز هستند، انجام گیرد [7 , 14 , 16]. با شواهدی که از مطالعات روی ژن‌های پروتامین­ها بدست آمده است، این موضوع مطرح شده که اگر ترتیب و ردیف موقتی از ترجمه پروتامین تغییر یابد، شکل­های غیر طبیعی هسته و حتی توقف کامل اسپرماتوژنز می‌تواند القا شود ] 23[.

بنابر گزارشات متعدد درمواردی وجود پلی‌مورفیسم یا جهش خاص در این ژن­ها سبب ناباروری مردان می‌شود، که در این تحقیق برای اولین بار ارتباط چهار پلی‌مورفیسم در ژن TNP2 شامل T1019G، G1272C،G deletion at 1036 and 1046 با ناباروری مردان ایرانی بررسی شده است. در این ژن دو پلی‌مورفیسم T1019G و G1272C با استفاده از روش PCR- RFLP (Restriction Fragment Length Polymorphism) و پلی‌مورفیسم­های
G deletion nt 1036 and 1046 با روش
PCR- SSCP (Single Strand ConformationPolymorphism) مورد بررسی قرار گرفتند.

روش RFLP یکی از راه­های بررسی وجود پلی‌مورفیسم‌ها و جهش‌های نقطه­ای، با استفاده از آنزیم‌های محدودالاثر می‌باشد. تغییر یک نوکلئوتید می‌تواند جایگاه اثری برای یک آنزیم بوجود آورد و سبب ایجاد قطعات کوچک‌تر از قطعه ژن مورد نظر در نمونه DNA دارای آن تغییر گردد. در موارد دیگر می‌تواند جایگاه اثری برای یک آنزیم را از بین ببردو سبب شود آن آنزیم قادر به برش دادن توالی ژن مورد نظر در محل دارای تغییر نوکلئوتیدی مورد بررسی نباشد. در هر دو حالت فوق، نمونه DNA-ایی که دارای تغییر نوکلئوتیدی است اگر تحت اثر آنزیم محدودالاثر ویژه قرار گیرد در مقایسه با سایر نمونه‌های معمول الگوی برش متفاوتی نشان می‌دهد]10[.

تکنیک SSCP تکنیک دیگری برای تشخیص
پلی مورفیسم­ها خصوصا حذف­های نوکلئوتیدی است و قادر به تشخیص تغییر، حتی در یک عدد باز می‌باشد. در این روش تک رشته DNA قادر به اتصال با خودش بوده که منجر به تشکیل یک شکل فضائی (ساختمان سوم) می‌گردد. ساختمان سوم یک قطعه DNA تک رشته بستگی به توالی بازی قطعه مورد نظر دارد و وقوع جهش در یک قطعه مشخص معمولاً منجر به تغییر شکل فضایی[6]DNA تک رشته واجد جهش نسبت به DNA تک رشته وحشی یا نرمال می‌گردد ]13[. در پایان برای تایید نتایج حاصل
نمونه­هایی با روش Sequencing تعیین توالی و بررسی شدند.

 

مواد و روش­ها

1- نمونه‌گیری:گروه بیمار از بین مردان ناباروری که به دلایل علل ناشناخته ژنتیکی، نابارور ادیوپاتیک تشخیص داده شده بودند، 96 نفر انتخاب شدند. این مردان دو زیر گروه، آزواسپرم که فاقد اسپرم و 77 نفر بودند و اولیگو اسپرم که دارای کمتر از پنج میلیون سلول اسپرم در میلی­لیتر و 19 نفر بودند، را شامل می‌شدند. این مردان در گروه سنی 30-45 سال قرار داشتند. گروه کنترل شامل 100 نفراز مردان بارور سالم بود، که درگروه سنی مشابه قرار داشتند و از نظر پارا مترهای فیزیولوژی و ساختمانی و نتایج کاریو تایپینگ دارای حالت نرمال بودند و دارای حداقل یک فرزند بودند. برای نمونه­گیری، از کلیه افراد 5 میلی لیتر خون محیطی در فالکون­های حاوی 500 میکرولیتر محلول آنتی کوالانت EDTA (20 میلی مولار باPH=8 و میزان 100میکرولیتر به ازاء هر یک میلی­لیتر خون محیطی) گرفته شد. نمونه‌های خون تا زمان استخراج DNA از هسته گلبول­های سفید خون در دمای C˚20- نگهداری شدند.

 

2- استخراج DNA:برای استخراج DNA ژنومیک از خون، روش استخراج نمکی DNAانجام گرفت و ازمواد و محلول­های زیر استفاده شد.بافر لیز کننده گلبول‌های قرمز - بافر P - سدیم دو دسیل سولفات(SDS) 10 درصد- پروتئیناز K باغلظت mg/ml 20- کلرید سدیم (Nacl) 6 مولار- اتانل 100%- اتانل 70%- بافر TE.

 

3-انجام PCR برای پلی‌مورفیسم­های مورد مطالعه:واکنش PCRبرای هرتکثیر هریک از پلی­مورفیسم­های T1019G، G1272CوG deletion at 1036 and 1046 در ژن TNP2انجام ‌گرفت. مشخصات ژن و پلی­‌مورفیسم­های مورد مطالعه در جدول 1 آمده است. همچنین مواد مورد نیاز برای PCR و مشخصات پرایمر‌ها و برنامه دستگاه PCR برای تکثیر پلی‌مورفیسم­های مذکور به ترتیب در جداول 2 و 3 و 4 آورده شده است.

5- الکتروفورزمحصولPCRبااستفاده از ژل آگارز:بعد از انجام واکنش PCR، جهت اطمینان از انجام صحیح واکنش PCR محصول حاصل از این واکنش روی ژل آگارز 5/1% الکتروفورز شد. در صورت مشاهده تشکیل باند اختصاصی با طولbp 473 روی ژل اگاروز از تکثیر قطعه مورد نظر اطمینان حاصل می‌گردد. در این حالت ادامه مراحل کار برای انجام واکنش­های هضم آنزیمی RFLPو SSCP وتعیین توالی یا  Sequencing امکانپذیر می‌باشد.

 

5-انجام روشRFLP برای تشخیص پلی­مورفیسم­ها:پس از انجام PCR، برای بررسی حضور دو
پلی­مورفیسم T1019Gو G1272C در ژن TNP2 از روش RFLP و با استفاده از هضم آنزیمی محصول PCR با  آنزیم­های محدودالاثر انجام گرفت. روش کار و مواد و محلول‌های مورد استفاده برای انجام RFLP عبارت بود از: برای انجام برش آنزیمی یک میکرو لیتر از محصول PCR را با یک میکرولیتر بافرX 10 و 2/0 میکرولیتر آنزیم 10 یونیت بر میکرولیتر که هر 1/0 آن معادل 1 میکرولیتر است، مخلوط شد و حجم کلی را با کمک آب دیونیزه به حجم 10 میکرولیتر رسانده شد. سپس نمونه‌ها را به مدت 16-2 ساعت در دمای °C­37برای آنزیم­های Ear I وHind IIIکه دمای بهینه آن آنزیم­ها بود، قرار داده شد. پس از اثر دادن آنزیم نتایج با الکتروفورز نمودن نمونه‌ها روی ژل آگاروز 5/1 % و مشاهده تعداد و طول باندهای تشکیل شده مشخص گردید. مشخصات آنزیم­های برش دهنده برای هضم آنزیمی محصول PCRپلی‌مورفیسم­های مورد مطالعه در این تحقیق در جدول 5 آورده شده است.

 

 

جدول 1- مشخصات پلی‌مورفیسم های مورد مطالعه

نام ژن

ID ژن

محل ژن

نام SNP

محل پلی‌مورفیسم

TNP2

7142

Ch 16p13. 13

T1019G

G1272C

G deletion in 1036 and 1046

Rs 2857758

Rs 8043625

L03378

 

جدول 2- مواد مورد نیاز برای واکنش PCR

مواد مورد نیاز

حجم

آب مقطر دونیزه

19 میکرولیتر

بافر PCR

5/2 میکرولیتر

Mgcl2

1 میکرولیتر

dNTP

5/0 میکرولیتر

هر یک از پرایمر‌های راست و چپ

5/0 میکرولیتر

DNA ژنومی نمونه مورد نظر

2/1-1 میکرولیتر

آنزیم Taq پلیمراز

2/0 میکرولیتر

حجم نهایی

25 میکرو لیتر

 

جدول 3- مشخصات پرایمرهای مورد استفاده در انجام PCR در این مطالعه

منابع مورد استفاده

توالی پرایمرها

نام ژن

*با استفاده از برنامه SNP cutter بدست آمد.

F- gtggttggtggatgaattggttag

R- ttctcctttgggtgaaacacgcag

 

TNP2

 

 

جدول4- برنامه PCR برای تکثیر پلی‌مورفیسم های مورد مطالعه

نام ژن

دناتوره شدن

دما - زمان

اتصال آغازگر

دما - زمان

سنتز DNA

دما - زمان

تعداد سیکل

PCR

طول قطعه تکثیر شده

bp

TNP2

°C94-1دقیقه

°C57-1دقیقه

°C72-1دقیقه

32

473

*با این توضیح که زمان و دمای دناتوره شدن اولیه برای دو پلی‌مورفیسم تکثیر داده شده بترتیب °C94 و 5 دقیقه

و زمان و دمای سنتز DNA برای دو پلی‌مورفیسم تکثیر داده شده بترتیب °C72 و 5 دقیقه می‌باشد.

 

جدول 5- قطعات ناشی از هضم آنزیمی محصولات PCR بدنبال استفاده از روش RFLP جهت تعیین پلی‌مورفیسم های مورد مطالعه.

ژن

پلی‌مورفیسم

آنزیم

سایت برش

برش اللی

طول PCR

طول قطعات حاصل بعد از برش

TNP2

T 1019 G

Ear I

C/TCTTC

الل جهش یافته

473

473 و 353 و 120

TNP2

G 1272 C

Hind III

AA/GCTT

الل جهش یافته

473

473 و 279 و 94

 

 


6-انجام روشSSCP برای تشخیص پلی­مورفیسم­ها:پس از انجام PCR، بررسی حضور دو پلی مورفیسم حذف نوکلئوتید G در موقعیت 1036 و 1046 توالی نوکلئوتیدی ژن TNP2، از روش SSCP انجام گرفت. در این تکنیک روش کار و مواد مورد استفاده عبارت بودند از:ابتدا محلول آکریل آمید جهت الکتروفورز محصولات PCR ژن TNP2 با طول قطعه بیش از bp 200 از ژل SSCP با 8% اکریلامید استفاده شد. برای تهیه این ژل محلول اکریلامید - بیس اکریلامید، بافر TBE 5X، آب دو بار تقطیر،APS 10% و TEMEDبه کار برده شد. پس از تهیه محلول ژل SSCP سریعا در فاصله دو شیشه ریخته شد. ژل 2-1 ساعت به ولتاژ 200-100متصل شد و سپس نمونه­های محصول PCR که با بافر مخصوص SSCP بارگیری شده بودندو به مدت 10 دقیقه در دمای 95 درجه سانتی­گراد قرار داده شده بودند بر روی یخ منتقل شده و پس از گذشت 5 دقیقه نمونه‌ها به چاهک‌های ژل انتقاال داده شدند. ابتدا ژل در دمای 4درجه سانتی‌گراد با ولتاژ 170 ولت به‌مدت 2-1 ساعت الکتروفورز شد و سپس با ولتاژ 60 یک شب الکتروفورز شدند. بعد از اتمام الکتروفورز ژل اکریل امید با روش نیترات نقره رنگ‌آمیزی شد.

 

7- مطالعات آماری: برای آنالیز نتایج تحقیق از
نرم­افزار SSPC استفاده شد و برای آزمون معنی­دار بودن اینکه آیا تغییر می‌تواند معیاری برایشناسایی بیمار از سالم باشد از مجذور خی استفاده شد.

 

نتایج

1- گروه بیماران:گروه بیمار مردان نابارور دارای نقص در روند اسپرماتوژنزیز را شامل می‌شدند. این افراد توسط پزشک متخصص اورولوژی مورد بررسی قرار گرفتند. با انجام یک سری آزمایشات اندرولوژی روی بیماران شامل بررسی تاریخچه پزشکی، معاینات فیزیکی، آنالیز مایع سیمن، آنالیز هورمونی برای میزان LH, FSH، بررسی کاریوتایپ بیماران و در برخی موارد بیوپسی بیضه صورت گرفت. از بین مردان ناباروری که برای درمان مراجعه کرده بودند و آزمایشات ذکر شده را انجام داده بودند، 25% بیمارانی بودند که دارای اختلال در تعداد، حرکت و ساختمان اسپرم بودند بدون آنکه اتیولوژی خاصی را نشان دهند و از نظر آزمایشات انجام شده و کاریوتایپ مشکلی نداشتند. در این افراد علل ژنتیکی ناشناخته علت ناباروری گزارش گردید. به این ترتیب که گروهی فاقد اسپرم بودند که در گروه آزواسپرمی گروه بندی شدند و در گروهی تعداد اسپرم کمتر از پنج میلیون سلول اسپرم در میلی لیتر بود که در گروه اولیگواسپرم قرار گرفتند. برای این تحقیق 96 نفر از مردان بررسی شده فوق که دارای ناباروری با دلایل ژنتیکی متعدد و گاه ناشناخته گزارش شدند و در گروه مردان نابارور ادیوپاتیک قرارگرفتند، انتخاب شدند. از این مردان 77 نفر آزواسپرم و 19 نفر اولیگواسپرم بودند و در گروه سنی 45-30 قرار داشتند. گروه کنترل از 100 نفر مرد سالم و باروری که در شرایط سنی و موقعیت جغرافیایی مشابه با گروه بیمار قرار داشتند، انتخاب شدند. نتایج دموگرافی افراد مورد مطالعه در جدول 6 آورده شده است.


 

جدول 6- دموگرافی گروه بیمار و کنترل در این مطالعه

افراد مورد مطالعه

گروه بیمار

ازو اسپرم + اولیگواسپرم

گروه کنترل

سالم و نرمواسپرم

تعداد

96 = 77 + 19

100

گروه سنی

(57/4 ± 04/37 ) 45-37

(31/5 ± 92/37 ) 45-26

تعداد اسپرم

0برای آزواسپرم­هاکمتر از 106×5 برای اولیگواسپرمها

بیشتر از106×20

حرکت اسپرم

0

بیشتر از 50%

مورفولوژی اسپرم

0

بیشتر از 30%


2-نتایج استخراج DNA از نمونه‌های خون گروه بیمار و کنترل:پس از استخراج DNA از نمونه‌های خون گروه بیمار و کنترل و تعیین غلظت آن با استفاده از دستگاه اسپکتوفتومتر، به میزان 1-5/0 میکرولیتر از نمونه‌های DNA روی ژل آگاروز 1 % الکتروفورز شدند. باند‌های تشکیل شده روی ژل آگاروز نشانگر اطمینان از حضور DNA در نمونه بود.

 

3- نتایج تکثیر پلی‌مورفیسم­های T1019G و G1272C و G deletions nt 1036 and 1046 در ژن TNP2:قطعه bp 473 از ژن TNP2 حاوی 4 پلی‌مورفیسم T1019G و G1272C وG deletions nt 1036 and 1046 در گروه بیمار و کنترل با روش PCR تکثیر شد. از هر نمونه PCR شده 5-3 میکرولیتربر روی ژل آگاروز 5/1 % الکتروفورز شد و سپس دراتیدیوم بروماید رنگ شد. تکثیر این ژن نشانگر یک باند منفرد به طول bp 473 در ژل آگاروز بود، که در شکل 1 آورده شده است.

 

4-نتایج RFLP برای تشخیص پلی‌مورفیسم­های T1019G و G1272Cدر ژن TNP2:برای بررسی این دو پلی­مورفیسم مورد مطالعه از تکنیکPCR – RFLP(هضم آنزیمی با آنزیم­های برش دهنده محصولPCR) استفاده گردید. محصولات هضم آنزیمی در این آزمون در جدول‌های 7 و 8 و شکل­های 2 و 3 آمده است.


 

شکل 1- نتایج مربوط به تکثیر قطعه bp 473 از ژن TNP2، چاهک1 مارکر با وزن مولکولی bp 100 می‌باشد و چاهک‌های 2و3و5 نمونه‌های محصول PCR از DNA بیمار و کنترل برای ژن TNP2 ( bp 473 ) می‌باشد وچاهک 4 و 5 به ترتیب نمونه کنترل منفی و کنترل مثبت می‌باشند.

 

جدول 7- نتایج مربوط به محصولات هضم آنزیمی برای پلی‌مورفیسم های مور مطالعه

طول قطعات

ایجاد شده با آنزیم

نوع ژنوتیپ

نام آنزیم

طول محصول

PCR

نام

پلی‌مورفیسم

نام ژن

473bp

473bp, 353bp, 120bp

353bp, 120bp

TT

TG

GG

EarI

473 bp

T 1019 G

TNP2

473bp

473bp, 378bp, 95bp

378bp, 95bp

GG

GC

CC

HindIII

473 bp

G 1272 C

TNP2

جدول8. نتایج فراوانی ژنوتیپ‌های پلی‌مورفیسم T1019G و G 1272 C از ژن TNP2 در گروه بیمارو گروه کنترل

فراوانی در گروه کنترل

فراوانی در گروه بیمار

نوع ژنوتیپ

نام ژن و پلی مورفیسم

100%

0

0

100%

0

0

TT

TG

GG

TNP2     T 1019 G

50%

33%

17%

51%

36.5%

12.5%

GG

GC

CC

TNP2     G 1272 C

 

 

شکل2- محصولات هضم آنزیمی برای پلی‌مورفیسم T1019G در ژن TNP2، چاهک 2 مارکر ژنتیکی bp 100، چاهک 1 نمونه uncut (bp 437)، چاهک 3 و4 نمونه هموزیگوت وحشی فاقد برش (TT) (bp 437)، نمونه هتروزیگوت برش یافته (TG) (bp 437 و bp353 و bp 120) و نمونه هموزیگوت موتان برش یافته (GG) (bp 353و bp 120) در هیچ یک از نمونه‌های بیمار و کنترل یافته نشد.

 

شکل3-محصولات هضم آنزیمی برای پلی‌مورفیسم G1272C در ژن TNP2، چاهک 5 مارکر ژنتیکی bp 100، چاهک 1 نمونه uncut (فاقد برش) (bp 437)، چاهک 2 نمونه هموزیگوت وحشی فاقد برش(GG) (bp 437)، چاهک 3 نمونه هموزیگوت موتان برش یافته (CC) (bp 375و bp 95) و چاهک 4 نمونه هتروزیگوت برش یافته (GC) (bp 437 و bp375 و bp 95).


5- آنالیز نتایج پلی‌مورفیسم­هایT1019G و
G 1272 C در ژن TNP2:با آنالیزآماری نتایج دو پلی‌مورفیسم T1019G و G 1272 C در ژنTNP2، و مقایسه بین داده‌های دو گروه بیمار و کنترل نشان داد بین این دو گروه تفاوت قابل ملاحظه­ایی وجود ندارد. بنابراین چنین می­توان نتیجه گرفت که بین حضور پلی‌مورفیسم­هایT1019G و G 1272 C در ژن TNP2ایجاد ازواسپرمی و اولیگواسپرمی در ناباروری مردان ایرانی از نظر آماری ارتباط معنی‌داری وجود ندارد (P>0.05). نتایج آنالیز آماری این دو پلی‌مورفیسم در جدول 9 آمده است.

 

6- نتایج بررسی جهش‌های حذفی نوکلئوتید Gدر ژن TNP2 با روش SSCP:دو پلی‌مورفیسمG deletion at 1036 and 1046در ژن TNP2 با روش SSCPبررسی شد. نتایج بررسی این دو پلی‌مورفیسم پس ازرنگ­آمیزی ژل آکریل آمید برای دو گروه بیمار و گروه کنترل چنین نشان داد که بین الگوهای باند‌های DNA تک رشته در ردیف‌های بالاتر ژل و باند‌های مربوط به DNA دو رشته­ایی در ردیف‌های پایینی در ژل در این جمعیت ها تفاوت معنی‌داری با یکدیگر مشاهده نشد. در نتیجه هیچ یک از افراد بیمار دارای حذف گوانین در منطقه 1036 و 1046 و دو پلی‌مورفیسم مذکور نبودند. نتایج برای این دو پلی‌مورفیسم در جدول 10 آمده است. نمونه‌هایی از الگوهای باند‌های تک رشته و دو رشته DNAتشکیل شده در روی ژل آکریل آمید پس از انجام روش SSCP، در شکل 4 آمده است.

 

 

جدول 9- نتایج آنالیز آماری برای دو پلی‌مورفیسم مورد مطالعه در مقایسه بین دو گروه بیمار و کنترل.

ارزش آماری

فراوانی در گروه کنترل

فراوانی در گروه بیمار

نوع الل

پلی مورفیسم

نام ژن

P= 0

100%

0

100%

0

T

G

T1019G

TNP2

P=0. 6

67%

33%

68.61%

31.37%

G

C

G 1272 C

TNP2

 

جدول 10- نتایج فراوانی ژنوتیپ‌ها ی جهش های حذفی گوانین در نوکلئوتیدهای 1036و 1046 در گروه بیمارو گروه کنترل

فراوانی در گروه کنترل

فراوانی در گروه بیمار

نوع ژنوتیپ

نام ژن و پلی مورفیسم

0

0

0

0

0

0

GG

G/-

-/-

TNP2         T 1019 G

0

0

0

0

0

0

GG

G/-

-/-

TNP2         G 1272 C


 

 

 

 

 

 

7-آنالیز نتایج جهش­هایحذف گوانین در نوکلئوتیدهای 1036و 1046 در ژن TNP2: نتایج آنالیزآماری پلی‌مورفیسم حذف گوانین در نوکلئوتیدهای 1036و 1046در ژن TNP2، با مقایسه بین داده‌های دو گروه بیمارو کنترل نشان داد بین این دو گروه اختلاف معنی‌داری وجود ندارد. بنابراین چنین نتیجه داد که بین حضورپلی‌مورفیسم حذف گوانین در نوکلئوتیدهای1036 و 1046در ژنNP2 با جمعیت مردان نابارور ایرانی و ایجاد اولیگواسپرمی و آزواسپرمی ارتباط معنی‌داری وجود ندارد (P > 0/05). نتایج آنالیز آماری این پلی‌مورفیسم در جدول 11 آمده است.

 

8- نتایج تعیین توالی محصولات PCR: نمونه محصول قطعه PCR برای ژن TNP2تعیین توالی گردید و نتایج تعیین توالی و همولوژی در بلاست آن در شکل 5 آورده شده است.

 

 

 

شکل 4- نتایج SSCP و تشکیل باند‌های تک رشته و دو رشته DNA در روی ژل آکریل آمید برای بررسی G deletions nt 1036 and 1046در ژن TNP2، چاهک 1 تا 4 نمونه DNA بیمارو خانه 5 تا 7 نمونه DNA کنترل (تمامی نمونه‌های گروه بیمار و کنترل دارای الگویی مشابه بودند).

 

 

جدول 11- نتایج آنالیز آماری برای دو جهش حذف گوانین در نوکلئوتیدهای 1036و 1046در ژن TNP2 در مقایسه بین دو گروه بیمار و کنترل.

ارزش آماری

فراوانی در گروه کنترل

فراوانی در گروه بیمار

نوع الل

پلی مورفیسم

نام ژن

P= 0

100%

0

100%

0

G

G Deletion

G deletion in 1036 and 1046 nt

TNP2

 

TNP2

Homo sapiens TNP2 gene for transition protein 2, complete cds

Length=1547

 

Score = 771 bits (854), Expect = 0. 0

Identities = 427/427 (100%), Gaps = 0/427 (0%)

Strand=Plus/Plus

 

Query 16 AGTTTTGATGGGTTGGTTTGATTGGTTAAATATTATCTTAATAGAGTAATATAGAGTAAT 75

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 978 AGTTTTGATGGGTTGGTTTGATTGGTTAAATATTATCTTAATAGAGTAATATAGAGTAAT 1037

 

Query 76 TGAATAAACAGAGAGAAGAATAGATATCTAGACTAATGGGATAGAATGGGAAAGAAATGT 135

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 1038 TGAATAAACAGAGAGAAGAATAGATATCTAGACTAATGGGATAGAATGGGAAAGAAATGT 1097

 

Query 136 TGAATAAATGAATGGAATGAGTGAACTAATGAATGGGTGGATGACAAATGGAAGGGATAA 195

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 1098 TGAATAAATGAATGGAATGAGTGAACTAATGAATGGGTGGATGACAAATGGAAGGGATAA 1157

 

Query 196 ATGGATGGATACCTGGATTCACATAGGTCAAAAGGACACTGACGGTAGTCTAAACTCTAT 255

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 1158 ATGGATGGATACCTGGATTCACATAGGTCAAAAGGACACTGACGGTAGTCTAAACTCTAT 1217

 

Query 256 CTATGTCCCATATTCAATCACAAATGAGTAGTTGTAAGACCTTACAGGAGGTCAAGGAGG 315

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 1218 CTATGTCCCATATTCAATCACAAATGAGTAGTTGTAAGACCTTACAGGAGGTCAAGGAGG 1277

 

Query 316 TCACTGACTTCATGAAGTGCTCAGCTATTAAAGGTTCCTTTCCCACTCTTATCCCTTAGG 375

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 1278 TCACTGACTTCATGAAGTGCTCAGCTATTAAAGGTTCCTTTCCCACTCTTATCCCTTAGG 1337

 

Query 376 ATGGAAATCCAACTAATGAGACCGCACTCCTTGGCTTGTTCCTGCGTGTTTCACCCAAAG 435

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 1338 ATGGAAATCCAACTAATGAGACCGCACTCCTTGGCTTGTTCCTGCGTGTTTCACCCAAAG 1397

 

Query 436 GAGAAAA 442

|||||||

Sbjct 1398 GAGAAAA 1404

شکل5- نتایج همولوژی در بلاست قطعه تکثیر شده از ژن TNP2 با PCR.

 


بحث

بر اساس مطالعات انجام شده کمتر از یک سوم دلایل ژنتیکی برای ناباروری هنوز ناشناخته هستند که بنام دلایل ژنتیکی ادیوپاتیک نامیده شده‌اند [1]. با وجود این که فاکتورهای محیطی می‌توانند نقش مهمی در ناباروری مردان داشته باشند، مطالعات امروزه تغییرات ژنتیکی را عامل موثری دراین امر می­داند و خصوصا توجه زیادی به علل ناباروری ادیوپاتیک شده است ]1 ، 8 و 22[.

بر این اساس در این تحقیق به بررسی ارتباط پلی‌مورفیسم­های معمول در ژن­هایی که بصورت ادیوپاتیک در ناباروری مردان نقش دارند پرداخته شده است. این پلی‌مورفیسم ها عبارتند از:

T1019G و G1272C وG deletions nt 1036 and 1046 در ژن TNP2و روش­های مولکولی رایج شاملRFLP SSCP  و  sequencingدر این بررسی‌ انجام گرفت. برای پلی مورفیسم G1272C در ژنTNP2 (P=0. 6) با فراوانی 37/31% برای الل C در گروه بیمار در مقایسه با گروه کنترل که 33% بدست آمد، تفاوت معنی‌دار بین گروه بیماران و گروه کنترل مشاهده نشد و نتایج نشان داد که بین آنها با جمعیت مردان نابارور ایرانی و ایجاد اولیگواسپرمی و آزواسپرمی ارتباطی وجود ندارد. پلی­مورفیسم­های T1019GوG deletion at nt 1036 and 1046 درژنTNP2در هیچ یک از گروه های بیماران و کنترل مشاهده نشد و دارای فراوانی صفر گزارش شدند، در نتیجه ارتباطی با ناباروری آدیوپاتیک در مردان ایرانی نشان ندادند.

اخیرا مطالعات زیادی در مورد پلی‌مورفیسم و جهش‌ها در ژن های پروتامین در جمعیت‌های مختلف انجام گرفته است و نتایج متفاوتی از این تحقیقات بدست آمده است و تعدادی از این مطالعات ارتباط معنی‌داری را بین پلی‌مورفیسم­های مورد مطالعه در ژن پروتامین­ها گزارش نموده‌اند ]5، 7، 8، 9 و 15[. بررسی چهار پلی‌مورفیسم T1019G و G1272C و G deletions nt 1036 and 1046 در ژن TNP2درجمعیت ایرانی و مقایسه حضور آن­ها در سایر جمعیت­ها، نتایج متفاوتی را نشان می دهد که ممکن است به دلایل تفاوت مناطق جعرافیایی و آب و هوایی که روی شرایط محیطی و عادات زندگی این افراد تاثیر مستقیم دارد باشد و یا به دلیل تفاوت تعداد افراد مورد بررسی و سن آن­ها باشد که می تواند در نتایج تحقیق اثر گذار باشد. همچنین ممکن است نوع تغذیه یا ابتلا به بیماری­های خاص و داروهایی که به طور زمینه ایی در بیماران مصرف شده، عاملی برای این تفاوت ها در جمعیت های مختلف مردان باشد که به این موارد پرداخته شده است.

برای ژن TNP2 در NCBI چندین پلی‌مورفیسم ثبت شده است. ازجمله این پلی‌مورفیسم‌ها می‌توان به T76G, G117C, C301T, C391T, C78T اشاره نمود که توسط ایمکن و همکارانش در سال 2009 در 135 مرد نابارور موروکایی و فرانسوی بررسی شدند و نتایج آنان نشان داد که تفاوت معنی‌داری با گروه کنترل نداشتند [9]. همچنین دو پلی‌مورفیسم T1019G و G1272C در جمعیت 282 مرد نابارور ژاپنی بررسی شدند و در نتایج مطالعات انجام گرفته، تفاوت معنی‌داری با گروه مردان بارورگزارش نشد [15]. در پلی مورفیسم های دسته دیگری از ژن های پروتامینی TP که ژن TNP1 است نیز مطالعاتی صورت گرفته است که مطالعه حیدری و همکارانش در سال 2014 روی 82 مرد نابارور ایرانی نشان داد در 15 مورد پلی مورفیسم T75C در گروه مردان نابارور مشاهده شد در حالیکه در هیچ یک از 80 مرد نرمال گزارش نشد و در نتیجه امکان تاثیر آن بر روند ناباروری مطرح گردید ]6[.

در این تحقیق نیز که به بررسی ارتباط بین چهار پلی‌مورفیسم در ژن پروتامینی TNP2 با ناباروری مردان ایرانی انجام گرفته است نتایج نشان داد که ارتباط معنی‌داری بین حضور پلی‌مورفیسم G1272Cدر ژن TNP2(P=0. 6) با ناباروری مردان وجود ندارد. همچنین پلی‌مورفیسم T1019Gو دو جهش حذفیG deletion at nt 1036 and 1046درژنTNP2 در هیچ یک از نمونه‌های مردان نابارورو بارورایرانی یافت نشد و چنین گزارش شد که بین حضور آن­ها در جمعیت مردان نابارور ایرانی و ایجاد اولیگواسپرمی و آزواسپرمی ارتباطی وجود ندارد.

مطالعات اخیر نشان داده است که ژن­های پروتامین بصورت کلاستر می‌باشند و بطور اختصاصی در روند اسپرماتوژنز(در تشکیل اسپرم بالغ) درپستانداران نقش دارند، به طوری که تغییرات کوچک در آن ها می‌تواند اثرات مهمی در تغییر بیان یا تغییر رونویسی و ترجمه این ژنها در پروسه اسپرماتوژنز دارا باشد [ 5 ، 8 و 23]. بنابراین چنین نتیجه گیری می شود که ژن‌های پروتامین، ژن‌هایی اختصاصی و با ساختمان ثابت هستند که برای روند اسپرماتوژنز نرمال ضروری‌اند و حضور پلی‌مورفیسم و جهش‌ها در این ژن ها می‌تواند سبب ناباروری مردان گردد. گرچه با توجه به این تحقیق و مطالعات گذشته این اثرات به ندرت سبب ایجاد ناباروری می‌شود ولی حضور این پلی‌مورفیسم‌ها و همچنین تغییرات اپی ژنتیک که در روند تغییرات پس از ترجمه این ژن ها اعمال می گردد می توانند به عنوان عاملی در تخریب روند اسپرماتوژنز مطرح باشند. همچنین با توجه به دامنه وسیع مطالعات در سال های اخیر و گستردگی مباحث مورد بحث در زمینه‌های ناباروری و تخصصی شدن هر یک از شاخه‌های مربوط به این دانش، لازم است تحقیقات‌ها با روش های جدید و شیوه‌های نوین در بررسی جهش­ها و پلی‌مورفیسم ها انجام پذیرد. همچنین برای برآورد نتایج دقیق‌تر و کامل تر شدن آن ها به بررسی در جمعیت های مختلف و هاپلو تایپ های متفاوت پرداخته شود. با توجه به این مسئله که روز به روز بر تعداد این جهش­ها و پلی‌مورفیسم­های جدید مرتبط با ناباروری افزوده می‌شود و تکنیک­های‌هایHigh through put و مدرن نیز در این رشته درحال افزایش است لزوم به کارگیری این متد‌ها در این زمینه ضروری است، خصوصا در بررسی‌هایی که به بررسی تعداد زیاد نمونه پرداخته می‌شود. بعنوان مثال روش HRM-RT PCRیا Size Fragmentation Analysis و یا روش­هایی که از microRNA‌ ها استفاده می‌شود و با Real Time PCR نتایج بررسی می‌شود می‌تواند راهگشایی برای مطالعات جامع‌تر و مثمر ثمر‌تری برای آینده باشد. خصوصا در زمینه درمان و فارماکولوژی این مطالعات می‌توانند مکملی بر کارهای گذشتگان باشد.

منابع

[1]     Aston K.I., Krausz C., Laface I., Ruiz-Castane E.D.T. 2010. Evaluation of 172 candidate polymorphisms for association with oligozoospermia or azoospermia in a large cohort of men of European descent. Human Reproduction 2010, 5: 1-15.

[2]      Dada R., Thilagavathi J., Venkatesh S., Esteves S.C., Agarwa A. 2011. Genetic Testing in Male Infertility. The Open Reproductive Science Journal, 3: 42-56.

[3]      El-Toukhy T.P.B. 2002. Male infertility and ICSI. Current Obstetrics and Gynaecology, 12: 276-285.

[4]     Ferlin A., Arredi B.C.F. 2006. Genetic causes of male infertility. Reprod Toxicol, 22: 133-141.

[5]      Gazouez C., Oriola J., De Mateo S., Vidal-Taboada J.M., Ballesca J.I. 2008. A comman protamine 1 promoter polymorphism (C190A) correlates with abnormal sperm morphology and increased protamine P1/P2 ratio in infertile patients. Journal of Andrology, 29: 540-548.

[6]      Heidari M.M., Khatami M., Talebi A.R., Moezzi F. 2014. Mutation analysis of  TNP1 gene in infertile men with varicocele. Iran J Reprod, 12(4): 257-262.

[7]     Hogarth C., Itman C., Jans D.A. 2005. Regulated nucleocytoplasmic transport in spermatogenesis: a driver of cellular differentiation? Bioessays, 27: 1011-1025.

[8]      Iguchi N., Yang S., Lamb D.J. 2006. An SNP in protamine 1: a possible genetic cause of male infertility? J Med Genet, 43: 382-384.

[9]      Imken L., Rouba H., EI Houate B., Louanjli N., Barakat A., Chafik A. 2009.  Mutations in the protamine locus: association with spermatogenic failure? Molecular Human Reproduction, 7: 1-22.

[10]  Jeffreys A.J. 2013. The man behind the DNA fingerprints: an interview with Professor Sir Alec Jeffreys. Investigative Genetics, 4(21): 1-7.

[11]  Katherine L., Varghes A.C., Agarwa A. 2010. The genetic causes of male factor infertility. Fertility and Sterility, 93(1): 1-12.

[12] Kempisty B., Depa-Martynow M., Lianeri M., Jedrzegczak P., Darul-Wasowicz A. 2007. Evaluation of protamines 1 and 2 transcript contents in spermatozoa from asthenozoospermic men. Folia Histochemica ET Cytobiologica, 45: 109-113.

[13]  Konstantinos K.V., Panagiotis P., Antonios V.T., Agelos P., Argiris N.V. 2008. PCR–SSCP: A Method for the Molecular Analysis of Genetic Diseases. Mol Biotechnol, 38: 155–163.

[14]  Lewin J.D., Abbott D.W.J. 2003. A haploid affair: core histone transitions during spermatogenesis. Biochem Cell Biol,, 81: 131-140.

[15]  Miyagawa Y., Nishimura H., Tsujimura A., Matsuoka Y., Matsumiya K., Okuyama A., Nishimune Y.H.T. 2005. Single-nucleotide polymorphisms and mutation analyses of the TNP1 and TNP2 genes of fertile and infertile human male populations. Journal of Andrology, 26(6): 779-786.

[16]  Oliva R. 2006. Protamines and male infertility. Human Reproduction Update, 12(4): 417-435.

[17]  Park Sh. 2016. Genetic Factors and Environmental Factors Affecting Male Infertility. International Research Journal of Advanced Engineering and Science, 1(3): 115-118.

[18]  Poongothai J., Gopenath T.S., Manonayaki S. 2009.Genetics of human male infertility. Singapore Med J, 50(4): 336-347.

 

 

[19]   Raheem A.A., Ralph D. 2011, Male infertility: causes and investigations. Trends in urology and mens health, 2(5): 8-11.

[20]  Ravel C., Chantot-bastaraud S., EI Houate B., Berthaut I., Verstraete L., De Larouziere V., Lourenco D., Dumaine A, Antoine J.M., Mandelbaum J. 2007. Mutations in the protamine 1 gene associated with male infertility. Molecular Human Reproduction, 5: 1-4.

[21]  Shamsi M.B., Kumar K., Dada R. 2011.  Genetic and epigenetic factors: Role in male infertility. Indian Journal of Urology, 27(1): 110-120.

[22]  Tanaka H., Miyagawa Y., Tsujimura A., Matsumiya K., Okuyama A.Y.N. 2003. Single-nucleotide polymorphisms in the protamine-1 and -2 genes of fertile and infertile human male populations. Molecular Human Reproduction, 9: 69-73.

[23]  Venkatesh S., Kumar R., Deka D., Deecaraman M., Dada R. 2011. Analysis of sperm nuclear protein gene polymorphisms and DNA integrity in infertile men. Systems biology in reproductive medicine, 57(3): 124-132.

[24]  Vogt P.H. 2004. Molecular Genetic of Human Male Infertility: From Genes to New Therapeutic Perspectives. Current Pharmaceutical Design, 10(1): 1-30.