اثر ویتامین C بر میزان آپوپتوزیس از طریق اندازه گیری بیان ژن (caspase (1 در قلب وریه جوجه های گوشتی مبتلا به سندرم هایپرتانسیون ریوی

نوع مقاله: مقاله پژوهشی

نویسندگان

1 استادیار گروه علوم پایه دانشکده دامپزشکی، واحد گرمسار،دانشگاه آزاد اسلامی،گرمسار،ایران.

2 دانش آموخته کارشناسی ارشد گروه علوم دامی،واحد گرمسار،دانشگاه آزاد اسلامی،گرمسار،ایران.

چکیده

سندروم هایپرتانسیون ریوی با ویژگی افزایش فشار شریان ریوی، اتساع و هایپرتروفی بطن راست به عنوان یکی از مشکلات جوجه های گوشتی که سرعت رشد بالایی دارند، مطرح می باشد. از طرف دیگر ثابت شده است  که میزان آپوپتوزیس در نارسایی قلبی و هایپرتانسیون ریوی افزایش می یابد. در این تحقیق برای اولین بار تاثیر ویتامین c بر میزان آپوپتوزیس از طریق اندازه گیری بیان ژن caspase1 در قلب و ریه جوجه های گوشتی مبتلا به سندرم هایپرتانسیون ریوی مورد بررسی قرار گرفت . بدین منظورتعداد 90 قطعه جوجه گوشتی بمدت 49 روز پرورش و جهت القاء هایپرتانسیون ریوی از هورمون (T3) استفاده شد. بعد از انجام PCR برای ژن caspase1 و actin-β به عنوان (Housekeeping gene) دانسیته هر یک از باندها اندازه گیری شده و به صورت نسبت caspase1/β-actin در گروه های مورد مطالعه (بطن راست و ریه) با یکدیگر مقایسه شد.میزان mRNA مربوط به ژنcaspase1 در بطن راست در سنین 21و49 روزگی و در بافت ریه در سن 49 روزگی کاهش معنی داری را در گروه درمانی نسبت به گروه بیمار نشان داد (05/0p<) که این اختلاف معنی دار بیانگر کاهش میزان آپوپتوزیس در گروهی است که با دریافت هورمون T3 مبتلا به سندرم هایپرتانسیون ریوی و در عین حال با ویتامین c درمان شده اند. همچنین نسبت RV/TV به عنوان شاخص القائ این سندرم در سن 49 روزگی در گروه درمان بهبود یافت.

کلیدواژه‌ها


عنوان مقاله [English]

Effect of vitamin C on apoptosis via measurement of caspase (1) gene expression in heart and lung of broiler chickens with pulmonary hypertension syndrome

نویسندگان [English]

  • hamed zarei 1
  • Azade Rashti 2
1 Assistant Professor,Department of Basic Sciences, Faculty of Veterinary Medicine, Garmsar Branch, Islamic Azad University, Garmsar, Iran
2 graduated of Animal Sciences, College of Agriculture, Garmsar Branch, Islamic Azad University, Garmsar ,Iran.
چکیده [English]

Pulmonary hypertension syndrome with high pulmonary arterial pressure, right ventricular hypertrophy and dilation is a problem of broilers. On the other hand it is proved that apoptosis in heart failure and pulmonary hypertension increases. In this study, for the first the effect of vitamin c on apoptosis by measuring the expression of caspase (1) in the heart and lungs of broilers with pulmonary hypertension syndrome was evaluated. T3 as a thyroid hormone was added to the ration after week 1 of rearing. Pulmonary hypertension was induced at 49 days based on RV/TV ratio index. After PCR for caspase1 and b-actin (Housekeeping) genes the density of each band were measured and were recorded as the ratio caspase1 / β-actin and this ratio were compared at different ages in witness groups (the right ventricle and lung). The amount of mRNA of the caspase 1 gene in the right ventricle at 21 and 49 days and in lung tissue at 49 days significantly reduced in the treatment group compared to the control group(p<0.05), this significant difference represents the reduction of apoptosis in the group who by receiving the hormone T3 were infected to pulmonary hypertension, and yet have been treated with vitamin C. Also, according to the results, the RV/ TV ratio improved in the treatment group.

کلیدواژه‌ها [English]

  • Apoptosis
  • pulmonary hypertension syndrome
  • vitamin C
  • caspase1

با افزایش روز افزون جمعیت جهان و افزایش نیاز به منابع پروتئینی، پروتئین های حیوانی بخصوص گوشت مرغ، به عنوان یک منبع تامین کننده پروتئین مورد توجه قرار گرفته است. به واسطه بهره جستن از
روش های مؤثر تغذیه ای، مدیریتی و ژنتیکی سرعت رشد طیور افزایش چشمگیری داشته است. به طوری که امروزه طیور گوشتی در کوتاه ترین زمان ممکن به رشد استاندارد رسیده و جهت عرضه به بازار آماده می گردند. این تغییرات باعث شده تا بیماری های
در قلب وریه / زارعی و همکار caspase (1) بر میزان آپوپتوزیس از طریق اندازه گیری بیان ژن Cاثر ویتامین

2 متابولیک از جمله سندرم هایپرتانسیون ریوی و آسیت، بروز و شیوع بیشتری بیابد. متناسب نبودن رشد بافت های قلبی - ریوی با میزان رشد و متابولیسم، از علل دخیل در افزایش این سندرم است. نیاز به اکسیژن از عوامل عمده بروز اولیه هایپرتانسیون ریوی در جوجه های گوشتی با سرعت رشد بالا است. برون ده قلبی بالا و افزایش فشار خون در ریه ها جهت اکسیژن گیری بیشتر از خون، منجر به بروز این عارضه و در نهایت منجر به بروز آسیت می شود. این سندرم، در جوجه های گوشتی آبشاری از وقایعی است که منجر به تغییراتی شامل بزرگ شدگی و شل شدگی قلب، هایپرتروفی بطن راست و تجمع مایع در حفره بطنی می ]. عوامل متعددی از جمله ارتفاع، 2و1[ شود سرما، تهویه نامناسب و انرژی بالا در جیره غذایی سبب بروز این سندرم می گردد. هورمون تیروئیدی (T ) با افزایش مصرف اکسیژن و اثر بر روی 3 مسیرهای مولکولی ویژه ای در قلب و عروق موجب اختلالات قلبی و عروقی می شود. به خوبی مشخص شده که پر کاری تیروئید موجب پرکاری قلب و عروق (افزایش برون ده قلبی و کاهش مقاومت عروق سیستمیک) شده و موجب تندتر شدن ضربان قلب، افزایش عملکرد سیستولیک و دیاستولیک و هایپرتروفی قلب می شود. اضافه کردن هورمون T تیروئیدی 3 (تری یدوتیرونین)به جیره جوجه های گوشتی، وقوع هایپرتروفی بطن راست و مرگ وابسته به آسیت را افزایش می دهد که احتمالاً این امر به طور ثانویه در اثر افزایش نیاز اکسیژن رخ می .]10و9 دهد [ آنتی اکسیدان ها ترکیبات شیمیایی هستند که در غلظت های کمتر از ماده اکسید شونده از اکسیداسیون ممانعت می کنند. از نظر بیولوژیکی آنتی اکسیدان ها به عنوان ترکیباتی تعریف می شوند که از سیستم زنده در
مقابل اثرات مضر محافظت می کنند و از واکنش هایی که باعث اکسیداسیون ترکیبات مولکولی با ساختارهای سلولی می شوند جلوگیری به عمل می آورند. در سیستم زنده، هنگام بروز اکسیداسیون، آنتی اکسیدان ها با رادیکال های آزاد ترکیب شده و از فعالیت آنها می کاهند. اسید اسکوربیک یکی از مهمترین آنتی اکسیدان های طبیعی محلول در آب می باشد. این آنتی اکسیدان در اثر متقابل با رادیکالهای آزاد، با جابجایی یک اتم هیدروژن موجب ثبات رادیکال آزاد می توکوفروکسیل را که C شود. به عنوان مثال ویتامین با رادیکالهای آزاد بدست آمده، Eاز ترکیب ویتامین به صورت توکوفرول احیاء درآورده و سپس به رادیکال آزاد منو آسکوربات تبدیل می شود. طی فعالیت های آنزیمی و غیرآنزیمی این رادیکال آزاد به اسکوربات و هیدرواسکوربات، که هیچ کدام رادیکال آزاد نیستند، تبدیل می در C شود. همچنین ویتامین کاهش اثر اکسیدان ها در تخریب اندوتلیوم عروق، به ]. از 22و21 ویژه عروق ریوی، تاثیر بسزایی دارد [ سوی دیگر ثابت شده است که میزان آپوپتوزیس در نارسایی قلبی و هایپرتانسیون ریوی افزایش می یابد ]. آپوپتوزیس نوعی از مرگ برنامه ریزی شده 8[ سلولی به صورت یکسری از مراحل ملکولی است که شود. در آپوپتوزیس 0منجر به مرگ آن سلول می یکسری از اتفاقات بیوشیمیایی منجر به تغییرات مورفولوژیک سلول می شود. مانند تورم سلولی، از بین رفتن متعلقات غشا،چروکیدگی سلول،تجزیه هسته و تکه کروموزومی. فرایند DNA تکه شدن ملکول آپوپتوزیس توسط سیگنال های سلولی گوناگونی کنترل می شود که این سیگنال ها ممکن است از محرک های خارج سلولی از قبیل هورمون ها، فاکتورهای رشد، نیتریک اکسایدو سیتوکنین ها و یا از محرک های
فصلنامه
زیست شناسی
تکوینی سال
3 هشتم، شماره
1395 ، تابستان

3
داخل سلولی مانند اتصال گیرنده هسته به گلیکوکورتیکوییدها، گرما، تشعشع، محرومیت از تغذیه، آلودگی ویروسی و هیپوکسی ناشی شوند. رویدادهای ملکولی مورد بحث در آپوپتوزیس بطور وسیعی توسط پروتئازهای سیستئین ویژه ای بنام میانجی می (caspases) شوند. بطور معمول پروسه آغازگر caspasesآپوپتوزیس توسط یک یا چند شروع می (caspase1,2,8,9,10) شود. کاسپازهای آغازگر یک یا چند کاسپاز اجرایی یا مؤثر در روند (cas ایجاد آپوپتوزیس را مانند بوسیله pase3,6,7) تقسیم پروآنزیم هایشان فعال می سازند. بنابر این میزان بیان ژن مؤید میزان بروز آپوپتوزیس caspase های می ]. از آنجا که بیشتر مطالعات تا کنون 15 و11 باشد [ در زمینه پاتوفیزیولوژی سندرم هایپرتانسیون ریوی صورت گرفته است و عمدتاً عواملی مانند افزایش فشار خون ریوی، اختلالات قلبی و رادیکال های آزاد را به عنوان مهمترین علل احتمالی آسیت در طیور گوشتی مطرح می کنند و توجه کمتری به جنبه های ملکولی و سلولی تأثیر گرفته شده از این سندرم در قلب و ریه جوجه های مبتلا صورت گرفته است،لذا بر آن شدیم تا از طریق اندازه گیری بیان ژن به عنوان شاخص،در بطن راست و ریه (caspase1) بر میزان آپوپتوزیس Cجوجه های مبتلا ،تاثیر ویتامین ایجاد شده در این سندرم را تعیین نمائیم.

مواد و روش کار - پرورش جوجه 1 308 قطعه جوجه گوشتی سویه راس 90تعداد قطعه30 گروه 3یک روزه به قطعه10 پن 3 ای در ای با سه تکرار به شرح زیر تقسیم بندی گردید.
گروه شاهد: دریافت کننده جیره پایه در کل دوره آزمایش گروه بیمار: دریافت کننده جیره پایه + هورمون تری (T یدوتیرونین به جیره غذایی از 1/5mg/kg با دوز 3) هفت روزگی گروه درمانی: دریافت کننده جیره پایه + هورمون تری (T یدوتیرونین به جیره غذایی از 1/5mg/kg با دوز 3) به آب 1200PPM به میزان Cهفت روزگی+ ویتامین مصرفی از ابتدای دورة پرورش قبل از ورود جوجه ها سالن و پن ها ضد عفونی و گاز داده شد. در تمام ساعات شبانه روز آب و دان به صورت آزادانه در دسترس جوجه ها بود و در طی شبانه روز حداقل سه بار وضعیت آب و دان حیوانات مورد بررسی قرار می گرفت. در طی پرورش جوجه ها تا روز دوازدهم از پیش دان و تا روز بیست و هشتم از جیره رشد و پس از آن از جیره پایانی استفاده گردید. مقدار انرژی قابل متابولیسم جیره درصد در 18-22، مقدار پروتئین جیره 2900-3050 نظر گرفته شد. در این سیستم پرورشی، سالن در شبانه ساعت فاقد نور بوده 1 ساعت دارای نور و 23روز، است. به منظور حفظ سلامت جوجه ها و ایمن سازی آنها علیه برخی بیماریهای ویروسی شایع در منطقه، برنامه واکسیناسیون بدین شرح اجرا شد: به صورت قطره colon30نیوکاسل: واکسن چشمی همراه با فرم روغنی واکسن دو گانه نیوکاسلوهمچنین 14آنفولانزا به صورت تزریقی در روز روزگی به صورت آشامیدنی 25واکسن لاسوتا در سن در جوجه ها استفاده شد. 4در سن (H120)برونشیت: واکسن برونشیت روزگی به صورت آشامیدنی داده شد.
در قلب وریه / زارعی و همکار caspase (1) بر میزان آپوپتوزیس از طریق اندازه گیری بیان ژن Cاثر ویتامین

4 روزگی به 27 و 17گامبورو:این واکسن در سنین صورت آشامیدنی داده شد. درجه حرارت محیط نیز بدین صورت تنظیم گردید که در ابتدای ورود، کلیه جوجه ها در دمای o قرار گرفتند. سپس در سه روز اول روزانه 320C C1 از دمای محیط کاسته گردید.پس از آن به طور متوسط o هر سه روز از دمای سالن کاسته شد تا اینکه 1 C o دوره پرورش، دما به 21درروز رسید. سپس تا 22 C o انتهای دوره دمای محیط در حدود C22-21 نگهداشته شد. جهت اندازه گیری دمای محیط در هر سالن از یک دما سنج استفاده گردید. دماسنج ها در سانتی 20ارتفاع متری سطح بستر جوجه ها قرار داده شده بودند.

- نمونه 2 برداری و تعیین میزان هایپرتروفی بطن راست در طی دوره پرورش دو بار نمونه برداری در از هر سه گروه انجام گرفت، به 49 و 21روزهای قطعه جوجه از هرگروه به 6 نحوی که هر بار تعداد طور تصادفی انتخاب و توزین شده و سپس تمامی جوجه ها با قطع نمودن شریان های کاروتید و وریدهای وداج ذبح شدند. پس از خروج کامل خون، هر یک به طور جداگانه بر روی میز خوابانده شده و محوطه شکمی آنها توسط قیچی جراحی شکافته می شد. در طی عمل کالبد گشائی وضعیت عمومی لاشه، میزان پرخونی و ادم، تجمع مایع در محوطه بطنی، وجود مایع اضافی در آبشامه قلب، وضعیت ریه ها، کلیه ها، کبد و همچنین ضایعات قلبی مورد دقت و ارزیابی قرار گرفت و وجود هر گونه حالت غیر طبیعی ثبت گردید و با قطع نمودن عروق متصل به قلب، قلب از قفسه سینه خارج شد. پس از جدا عروق بزرگ، ،نمودن قلب هر جوجه از لاشه
سینوس ها، دهلیزها و چربی های اطراف قلب بوسیله قیچی جراحی به دقت جدا می گردید تا فقط بطن ها باقی بمانند. سپس بطن راست به دقت توسط قیچی جراحی از محل اتصال آن به دیواره بین دو بطن بریده شد و هر دو بطن از وجود احتمالی لخته های خون کاملاً پاک شد. سپس وزن بطن راست و وزن مجموع دو بطن به صورت جداگانه با ترازوی حساس تعیین شد و نهایتا شاخص وزنی قلب مربوط به هر یک از جوجه ها به صورت نسبت وزن بطن راست به وزن مجموع هر دو بطن ( RV/TV ) بر حسب گرم مورد محاسبه قرار گرفت.در صورتی که این نسبت بیشتر از باشد آن جوجه مبتلا به هایپرتانسیون ریوی شده 0/29 ]. بطن راست و ریه19است [ های جدا شده جوجه های مورد نظر در لوله های سرپوش دار مقاوم به ) در ظرف حاوی ازت مایع قرار Cryotube( انجماد o داده شد و در اسرع وقت به فریزر با دمای C70- منتقل گردید.

از بافت قلب (بطن RNA - استخراج و خالص سازی 3 راست) و ریه در آزمایشگاه لوله های حاوی بافت ریه وقلب از o فریزر - خارج گردید و با روش تک مرحله 70 C و 1 ای یا همان روش استخراج اسید گوانیدیم تیوسیانات - کل بافت RNA] طی مراحل زیر، 3 فنول - کلروفرم [ ریه وقلب استخراج گردید: تکه ای از بافت ریه وقلب در هاون همراه با مقداری ازت مایع خرد و به صورت  از بافت ریه، 100mg پودر درآمد. - به ازای هر l500 میلی1/5از محلول دناتور کننده در یک لوله لیتری به آن اضافه گردید.- محلول دناتوره کننده شامل: سدیم سیترات ،25g )4Mگوانیدیوم تیوسیانات (
1 Single - step
فصلنامه
زیست شناسی
تکوینی سال
3 هشتم، شماره
1395 ، تابستان

5
%) به مقدار10, سارکوزیل (1/8ml) به میزان 0/75M( بود.- در هنگام استفاده به 29/3ml و آب مقطر 2/6ml  میلی لیتر از محلول فوق 50 - مرکاپتواتانل 2 از 350 l (2 -) اضافه شد. ME  - به لوله فوق سدیم استات به مقدار اضافه 50 l گردید. -   از فنل اشباع شده با آب و 500 l از محلول 200 l ) اضافه گشته و 49:1کلروفرم ایزوآمیلوالکل ( بخوبی مخلوط شد.- لوله حاوی مواد فوق را به درجه 4 دقیقه در درجه حرارت 15مدت سانتی دقیقه 20 گراد قرار داده و سپس به مدت درجه سانتی 4توسط سانتریفوژ یخچال دار در ،سانتریفوژ گردید.- فاز مایع 9000rpm گراد در دور به یک لوله اپندورف جدید منتقل گردید.- هم %) اضافه 100حجم مایع از محلول ایزوپروپانول ( -) درجه 20( شده و بعد از تکان دادن، در دمای دقیقه قرار گرفت. - لوله 30سانتی گراد به مدت دقیقه 10 درجه سانتی گراد به مدت 4مذکور در سانتریفوژ شد.- رسوب مجدداً در 9000rpmبا دور  - محلول دناتور کننده حل شد. 300 l از 300 l دقیقه در 15% اضافه کرده و 100ایزوپروپانول - درجه سانتی گراد قرار گرفت. 20دمای دقیقه 10 به مدت 9000rpm با دور 4oC - لوله فوق در  -سانتریفوژ شد و مایع رویی خارج گردید. l200 %) به رسوب ته لوله اضافه شد و 75از اتانول ( دقیقه در 15 تا 10ورتکس گردید. سپس به مدت 25oC دمای آزمایشگاه قرار گرفت.- لوله فوق در دقیقه سانتریفیوژ شده 5 به مدت 9000rpmبا دور و مایع رویی خارج شد.

با توجه به احتمال آلودگی محلول بدست آمده از ، ضروری بود به روش زیر DNAاستخراج فوق به با خلوص بالا در اختیار RNA حذف گردیده تا DNA موجود در محلول RNAداشته باشیم: ابتدا میزان با روش RNAحاصله از مراحل استخراج اندازه گیری 260nmاسپکتروفتومتری در طول موج موجود در RNA میکروگرم از 1 شد.- به ازای هر و Iمحلول یک واحد از آنزیم دزوکسی ریبونوکلئاز تریس اسید 100mM یک حجم از بافر مربوطه (حاوی کلرید 0/1mM کلرید منیزیم و 2/5mMکلریدریک، کلسیم) اضافه گردید.- حجم نهایی محلول فوق - رسانده شد. 10ml به DEPCتوسط آب حاوی o محلول فوق در - دقیقه قرار گرفت. 30 بمدت 37 C ، با قرارگرفتن لوله Iدر انتها، دزوکسی ریبونوکلئاز o حاوی محلول فوق در درجه حرارت به مدت 65 C خنثی EDTA از 2/5mM دقیقه، در حضور 10 موجود در محلول دوباره توسط RNA .گردید مورد ارزیابی 260nmاسپکتروفتومتری در طول موج قرار گرفت و میزان خلوص آنها بررسی شد. بدین 2 تا 1/8 بین OD260/OD280صورت که اگر نسبت RNAبود نشان دهنده خلوص قابل توجه است. کیفیت RNA توسط 1/5الکتروفورز ژل آگارز ) نیز 1mg/mlدرصد، با رنگ آمیزی اتیدیوم بروماید( مورد بررسی قرار گرفت.

4- RT - نیمه کمی PCR )cDNA( DNAهدف از این مرحله ابتدا تهیه کپی بوووده کووه تحووت عنوووان رونوشووت بوورداری RNAاز بوا DNA) نامیده می شود و سپس این RT( 1معکوس

1 Reverse transcription
در قلب وریه / زارعی و همکار caspase (1) بر میزان آپوپتوزیس از طریق اندازه گیری بیان ژن Cاثر ویتامین

6 روش واکونش زنجیوره (PCR) ای پلوی موراز افوزوده 1 ابتودا مووادی cDNA سازی می گردد. جهت سواخت  ( RNAشامل dNTP) و 200ng)، راندوم هگزامور ( 1 g میلی لیتری اپندورف ریخته 0/5) در یک لوله 0/5mM( و حجم نهایی این محلوول توسوط آب مقطور بوه l20 درجوه سوانتی 65 دقیقه در 5رسانده و سپس به مدت گراد قرار داده شد. RNaseدر مرحله بعد به این محلول ، مهار کننده (شامل تریس - اسید کلریدریک RT واحد)، بافر 40( ، )3mM)، کلرید منیزیم (75mM)، کلرید پتاسیم (50mM( ) و آنزیم رونوشت برداری معکوس به 10mM( DTT M نام واحد)، اضافه شد. محلول حاصله 200( -MLV درجه سانتی25 دقیقه در 10به مدت 50 گراد و سپس درجه سانتی 37دقیقه در گراد قرار گرفت.در مرحله درجه سانتی75 آخر محلول را در درجه حرارت گراد دقیقه قرار داده تا آنزیم رونوشت برداری 15به مدت معکوس غیر فعال شود. در مرحله بعد با استفاده از caspase1 پرایمر اختصاصی برای )1 (جدول قسمت تکثیر caspase 1 مربوط به mRNA هایی از گردید.

caspase1مواد لازم برای هر واکنش در این مرحله برای عبارتند از: ) که 1X( PCR )- بافر 2mM( dNTPمخلوط )، کلرید سدیم 5mMشامل: تریس اسید کلریدریک ( )، تریتون 0/1mM( DTT) و 0/01mM( EDTA ،)10mM( ( %5%) و گلیسرول 0/1( x-100 )- کلرید 2/5 l مربوط به R+F ) - پرایمر اختصاصی 1/5mMمنیزیم ( caspase (1) ( M2) - cDNA ( )- پلی مراز 0/5 l واحد)0/5( Taq
1 Polymerase chain reaction
بعد از مخلوط کردن مواد فوق در یک لوله اپندورف، حجم مخلوط را با آب مقطر (یونیزه) به قرار Thermocyclor رسانده و سپس در دستگاه 25l دادیم، البته قبلا دستگاه به صورت زیر برای ژن برنامه ریزی گردید:caspase 1

:casepase1 برای ژن PCRبرنامه حرارتی درجه سانتی94 دقیقه در 2 )الف گراد جهت بازشدن )pre Denaturation( DNAاولیه دو رشته درجه سانتی94 ثانیه در 50ب) گراد جهت باز شدن (Denaturation) دو رشته DNA درجه سانتی 68 ثانیه در 50ج) گراد جهت اتصال )Annealing( پرایمرها به توالی هدف درجه سانتی 72 ثانیه در 45 د) گراد جهت طویل (Extension) شدن رشته های جدید

سیکل 25سه مرحله آخر حرارتی (از ب تا د) در تکرار گردید. در این روش ژن داخلی استانداردی به نام (– نامیده Housekeeping gene) که اصطلاحا  actin می شود نیز تکثیر گردید تا در هنگام سنجش دانسیته ، مقادیر بدست آمده با دانسیته caspase1باندهای ژن باند این ژن داخلی مقایسه گردد. در واقع به همین )Semiquantitativeدلیل این روش را نیمه کمی ( .]16و10نامیده اند [

– مواد لازم برای هر واکنش در این مرحله برای actin  عبارتند از: ) که 1X( PCR )- بافر 1/5mM( dNTPمخلوط )، کلرید سدیم 5mMشامل: تریس اسید کلریدریک ( )، تریتون 0/1mM( DTT) و 0/01mM( EDTA ،)10mM(
فصلنامه
زیست شناسی
تکوینی سال
3 هشتم، شماره
1395 ، تابستان

7
( %5%) و گلیسرول 0/1( x-100 )- کلرید 2/5 l مربوط به R+F ) - پرایمر اختصاصی 1/5mMمنیزیم ( (– actin  )( M2) - cDNA ( )- پلی 1 l Taq مراز واحد). بعد از مخلوط کردن مواد فوق در یک 0/2( – لوله اپندورف برای ژن ، حجم مخلوط را با  actin آب مقطر (یونیزه) به رسانده و سپس در دستگاه 25 l قرار دادیم، البته قبلاً دستگاه به Thermocyclor – صورت زیر برای ژن : برنامه ریزی گردید actin

– برای ژن PCRبرنامه حرارتی actin : درجه سانتی94 دقیقه در 3 )الف گراد جهت بازشدن )pre Denaturation( DNAاولیه دو رشته درجه سانتی94 دقیقه در 1ب) گراد جهت باز شدن دو رشته DNA (Denaturation) درجه سانتی 68 ثانیه در 60ج) گراد جهت اتصال )Annealing( پرایمرها به توالی هدف درجه سانتی 72 ثانیه در 60د) گراد جهت طویل (Extension)شدن رشته های جدید

سیکل 24سه مرحله آخر حرارتی (از ب تا د) در تکرار گردید. و caspase1 برای دو ژن PCRبعد از انجام باندهای مربوطه را با استفاده از عمل ژل –actin %متمایز ساخته و پس از 1/5الکتروفورز در ژل آگارز )، توسط اشعه 1mg/ml(رنگ آمیزی با اتیدیدیم برماید ماوراء بنفش مورد مشاهده قرار گرفت. سپس باندهای حاصله را با باندهای مارکر استفاده شده در ژل الکتروفورز مقایسه کرده تا اندازه تقریبی باندها مشخص شود. اندازه های بدست آمده با اندازه های مورد انتظار مقایسه شده تا از اختصاصی بودن باندهای بدست آمده برای هر ژن اطمینان حاصل گردد. در
مرحله انتهایی که دانسیتومتری است، با استفاده از photo برنامه کامپیوتری -capt v.99 Image softwave ، دانسیته هر یک از باندها اندازه گیری شده و سپس با – دانسیته باندهای مربوطه مقایسه و به صورت  actin ثبت گردید. caspase1/βactinنسبت

- محاسبات آماری 5 SPSS-14برای انجام محاسبات آماری از نرم افزار استفاده شده و جهت مقایسه مقادیر هر یک از متغیرها one مابین سه گروه بیمار،درمانی و شواهد از آزموون ( ) اسووتفاده گردیوود. در مواردیکووه احتمووال way anova ) شد، اختلاف از نظور آمواری P<0/05( 0/05کمتر از ±معنی دار تلقی گردید. کلیه نتایج به صورت میانگین
خطای اسوتاندارد از میوانگین )( SEMMean درج  گردید.

نتایج خطای معیار از میانگین نسبت وزن ± - مقایسه میانگین 1 ) بین گروهRV/TVبطن راست به وزن هر دو بطن ( های بیمار، درمانی و شاهد در سنین مختلف: 2با توجه به نتوایج ارائوه شوده در جودول شوماره )RV/TVنسبت وزن بطن راست به مجموع دو بطون ( روزگی در گروه بیمار نسوبت 49 و 21در هر دو سن به هر دو گروه شاهد و درمانی افزایش یافته است کوه روزگی نسبت به گروه درموانی 21این افزایش در سن روزگی نسبت به هر دو گروه درموانی و 49و در سن شوواهد از لحوواا آموواری دارای اخووتلاف معنووی داری می 49 ).همچنوین ایون نسوبت در سون p<0/05 باشد ( شوده اسوت کوه 0/29روزگی در گروه بیمار بیشتر از نشان دهنده بروز سندرم هایپرتانسیون ریووی در ایون .]19گروه است [
در قلب وریه / زارعی و همکار caspase (1) بر میزان آپوپتوزیس از طریق اندازه گیری بیان ژن Cاثر ویتامین

8 خطای معیار از میانگین نسبت ± - مقایسه میانگین 2 دانسیته دربافت ریه PCRحاصل از caspase1/-actin بین گروه های شاهد ، بیمار و درمانی در سنین مختلف: caspase1/ نسبت دانسیته بافت ریه در -actin 3گروه های شاهد ، بیمار و درمانی در جدول شماره با یکدیگر مقایسه شده است.با توجه به نتایج به دست بافت ریه در caspase1 مربوط به mRNAآمده میزان روزگی در گروه درمانی نسبت به گروه بیمار 49سن کاهش معنی .)p<0/05( داری را نشان داده است

خطای معیار از میانگین نسبت ± - مقایسه میانگین 3 دانسیته در بطن PCRحاصل از caspase1/-actin
راست بین گروه های شاهد، بیمار و درمانی در سنین مختلف: caspase1/ نسبت دانسیته 4در جدول شماره بافت بطن راست در گروه های شاهد، بیمار و -actin درمانی با یکدیگر مقایسه شده است. با توجه به نتایج caspase1 مربوط به mRNAبه دست آمده میزان روزگی در 49 و 21بافت بطن راست در هر دو سن گروه درمانی نسبت به گروه بیمار کاهش یافته است که این کاهش از لحاا آماری دارای اختلاف معنی دار می 49). همچنین این میزان در سن p<0/05 باشد ( روزگی در گروه درمانی نسبت به گروه شاهد افزایش معنی داری را نشان می .)p<0/05 دهد (

در این مطالعهPCR - مشخصات پرایمرهای مورد استفاده در انجام 1جدول
Accossion No,
Size of PCR Product
Cycles, Annealing ternperatare
.primerَ5 .primerَ3 Gene
LO8165 468 bp 24 -60 Oc TTAGAAGCATTTGCGGTGGACAA ACTGGATTTCGAGCAGGAGAT  –actin AF031351.1 347 bp 25-64 Oc AGGGAGCTGTCACAGTGCGT CGGCCAGCGCCATCTTCATT Caspase1

) بین گروه های مورد مطالعه در سنین مختلفRV/TV - نسبت وزن بطن راست به وزن هر دو بطن ( 2 جدول سن (روز) گروه درمانی گروه بیمار گروه شاهد 21 b00/0 ±20/0 a00/0 ±26/0 a00/0 ±24/0 49 a01/0 ±23/0 b01/0 ±31/0 a01/0 ±22/0 )p<0/05 حروف غیر مشابه نشان دهنده وجود اختلاف معنی دار بین گروه ها در یک سن خاص است ( a.b

caspase1/ - نسبت دانسیته 3جدول در بافت ریه بین گروه های مورد مطالعه در سنین مختلفPCR حاصل از -actin سن (روز) گروه درمان گروه کنترل گروه شاهد 21 14/0± 86/1 25/0 ± 11 /2 17/0 ± 73 /1 49 a19/0 ±20/2 b17/0 ±10/4 a19/0 ±03/2 .)p<0/05 حروف غیر مشابه نشان دهنده وجود اختلاف معنی دار بین دو گروه در یک سن خاص است ( a.b

caspase1/ - نسبت دانسیته 4جدول در بطن راست بین گروه های مورد مطالعه در سنین مختلفPCRحاصل از -actin سن (روز) گروه درمان گروه کنترل گروه شاهد 21 a22/0± 74/2 b24/0± 80/3 a30/0± 32/2 49 c19/0 ±54/2 b34/0 ±75/4 a30/0 ±33/1 .)p<0/05حروف غیر مشابه نشان دهنده وجود اختلاف معنی دار بین دو گروه در یک سن خاص است (a.b.c
فصلنامه
زیست شناسی
تکوینی سال
3 هشتم، شماره
1395 ، تابستان

9

باند گروه شاهد، درمانی و کنترل. 6 در بافت بطن راست. به ترتیب از سمت چپ به راست به فاصله هر caspase1 - ژل الکتروفورز ژن 1شکل  (ردیف بالا ) caspase1 - و ردیف پایین actin


باند گروه شاهد،درمانی و کنترل. (ردیف 6 در بافت ریه. به ترتیب از سمت چپ به راست به فاصله هر caspase1 - ژل الکتروفورز ژن 2شکل  بالا ) caspase1 - و ردیف پایین actin
بحث بررسی های اخیر نشان داده است که در شرایط طبیعی، هر عاملی که موجب افزایش فعالیت های متابولیکی جوجه های گوشتی شود میزان بروز هایپرتانسیون ریوی و آسیت را افزایش می دهد. افزایش سرعت رشد، کاهش درجه حرارت، تغذیه باجیره های پر انرژی, یا مصرف جیره های پلت شده از جمله عواملی هستند که می توانند با بالا بردن فعالیت های متابولیکی موجب افزایش مصرف اکسیژن در پرنده و در نهایت بروز آسیت در طیور گوشتی ]. در مطالعه حاضر هدف از افزودن 20و1شوند [ T هورمون به جیره غذایی جوجه 3 های گوشتی، افزایش متابولیسم و در نتیجه افزایش مصرف اکسیژن و فعالیت های متابولیکی بوده است. افزایش نیاز به اکسیژن باعث هیپوکسی بافتی شده که جهت جبران آن و رفع نیازهای بافتی بر برون ده قلبی افزوده می شود و بدنبال آن جریان خون ریوی بیشتر شده منجر به بروز افزایش فشار خون ریوی و نهایتاً آسیت می شود. به خوبی مشخص شده که پرکاری تیروئید موجب پرکاری قلب و عروق (افزایش برون ده قلبی و کاهش مقاومت عروق سیستمیک)شده،که موجب تندتر شدن ضربان قلب، افزایش عملکرد سیستولیک و دیاستولیک و هایپرتروفی قلب می ]. زمانی که به هر 6و1[ شود علتی فعالیت متابولیکی بافت های مختلف بدن افزایش جریان خون موضعی بافتی افزایش یافته و ،یابد موجب کاهش فشار خون عمومی بدن می شود که در این شرایط قلب با افزایش فعالیت خود سعی در جبران فشار خون کاهش یافته می کند که البته در طولانی مدت می تواند موجب هایپرتروفی قلب و در واقع بیان کننده RV/TVنارسایی آن گردد. مقدار میزان هایپرتروفی بطن راست در مقایسه با کل توده بطنی است و نشان می دهد که چه نسبتی از وزن بطن ها مربوط به بطن راست است. بنابراین در تعیین میزان این نسبت دو عامل تعیین کننده وجود دارد که عبارتند از وزن کل بطن ها و وزن بطن راست. افزایش این نسبت می تواند به علت هیپرتروفی بطن راست باشد.هیپرتروفی دیواره بطن راست مستقیماً با افزایش فشار سرخرگ های ریوی در ارتباط است و نسبت می تواند سنجشی برای فشار بار روی بطن RV/TV مهمترین شاخص RV/TVراست باشد. بنابراین نسبت برای تعیین هایپرتروفی بطن راست و هایپرتانسیون
در قلب وریه / زارعی و همکار caspase (1) بر میزان آپوپتوزیس از طریق اندازه گیری بیان ژن Cاثر ویتامین

10 ]. مشخص گردیده است که رشد 19ریوی است [ ریه ها در جوجه های گوشتی در مقایسه با رشد بدن، ]، که افزایش وابسته به سن نسبت 2[ کندتر است در گروه بیمار را می RV/TV توان به همین موضوع نسبت داد. در گروه بیمار در تمام مراحل نسبت بزرگتر از گروه شاهد و درمان است (این RV/TV 49 نسبت به گروه درمان و در روز21افزایش در روز نسبت به هر دو گروه شاهد و درمان معنی دار است). W در مجموع با توجه به تعریفی که در سال ideman از سندروم هیپرتانسیون ریوی داشته است بدین 2001 نشان 0/29 به بیش از RV/TVمعنی که افزایش نسبت ] وبا 19دهنده حضور این سندروم در پرنده است [ توجه به داده 49 های بدست آمده، این سندرم در روزگی گروه کنترل را کاملاً درگیر کرده است. افزایش استرس های اکسیداتیو شرایطی را توصیف می کند که در آن آنتی اکسیدان های سلولی قادر به غیرفعال کردن رادیکال های آزاد واکنش دهنده نیستند. غلظت بالای این عوامل استرس با افزایش پراکسیداسیون لیپیدی و تولید مقدار زیادی مالون دی آلدئید به نوکلئیک اسید، لیپید و پروتئین های سلولی آسیب می رسانند که به وسیله واکنش های ثانویه باعث بروز نکروز، آپوپتوزیس و سرانجام مرگ سلول می شود که در نتیجه عدم تعادل داخلی و ایجاد بیماری را داریم ]. همانطور که نتایج نشان داده است گروهی از 13[ جوجه تحت C ها که توسط مقادیر مختلف ویتامین درمان قرار گرفته بودند، این معیار قلبی تا حدود زیادی اصلاح شده است که می تواند ناشی از اثرات آنتی در این سندرم باشد. تاکنون C اکسیدانی ویتامین بیشتر مطالعات در زمینه پاتوفیزیولوژی سندرم هایپرتانسیون ریوی صورت گرفته است و عمدتا عواملی مانند افزایش فشار خون ریوی، اختلالات قلبی
و رادیکال های آزاد به عنوان مهمترین علل احتمالی آسیت در طیور گوشتی مطرح شده است و توجه کمتری به جنبه های ملکولی و سلولی تأثیر گرفته شده از این سندرم در قلب و ریه جوجه های مبتلا صورت به (caspase1) گرفته است، اندازه گیری بیان ژن عنوان شاخص،در بطن راست و ریه جوجه های مبتلا، میزان آپوپتوزیس ایجاد شده در این سندرم را تعیین می و همکارانش در Upadhyay]. در مطالعه 14 نماید [ به caspase مشخص شده است که فعالیت 2004سال طور معنی داری در رت های هایپرتیروئید افزایش یافته است و نشان داده اند که افزایش هورمون های تیروئیدی سبب ازدیاد میزان آپوپتوز می .]17[ گردد اعلام نمودند که 2010 و همکاران در سال Wang T4میزان آپوپتوزیس در قلب رتهایی که در معرض قرار داشتند افزایش یافته است و آنها پیشنهاد نمودند که ازدیاد میزان آپوپتوزیس قلب را به سمت نارسا شدن هدایت می ]. از سوی دیگر نیز ثابت 18 نماید [ شده که میزان آپوپتوزیس در نارسایی قلبی و هیپرتانسیون ریوی افزایش یافته است. حسن پور و عنوان نمودند که میزان بیان 2014همکاران در سال و به دنبال آن میزان آپوپتوزیس در caspase1,2,3 ژن قلب و ریه جوجه های گوشتی مبتلا به سندرم هایپرتانسیون ریوی القاء شده با هورمون تیروئیدی افزایش می ]. افزایش آپوپتوزیس نقش مهمی 11[ یابد در انواع ایسکمی های آسیب رسان، از جمله ایسکمی میوکارد که در اثر خونرسانی ناقص و کاهش میزان اکسیژن اتفاق می افتد، ایفاء می کند و باعث مرگ کاردیومایوسیت ها در موش های ترانس ژن می شود . همچنین آسیب ناشی از ایسکمی باعث شروع آپوپتوزیس می گردد و اگر ایسکمی ادامه پیدا کند، ]. بررسی بر روی 12 و7تبدیل به نکروز خواهد شد [
فصلنامه
زیست شناسی
تکوینی سال
3 هشتم، شماره
1395 ، تابستان

11
مدل های حیوانی از جمله موش، رت، خرگوش و سگ و همچنین مدل انسانی نشان داده است که سیتوزولیک که در پاسخ به تحریک Cسیتوکروم آپوپتوزیس از میتوکندری آزاد می گردد و همچنین در Caspaseپروآنزیمهای فعال کننده آپوپتوزیس بنام هر دو مدل حیوانی و انسانی متعاقب نارسائی قلبی آشکار می BCl گردند و همچنین پروتئین - که به 2 عنوان مهار کننده آپوپتوزیس مطرح است بعد از نارسائی حاد کرونر بخصوص در میوکارد بهبود یافته در سطح بالایی تنظیم می BC1 ]. تعادل بین 8[ شود -2 و Baxبه عنوان مهار کننده آپوپتوزیس و پروتئین به عنوان القاء کننده آپوپتوزیس به Bad همراه پروآنزیم در افزایش میزان آپوپتوزیس در سلول Caspase های ]. متعاقب هایپرتانسیون ریوی 4قلبی بسیار مهم است [ میزان آپوپتوزیس در سلول های عضلات صاف عروق خونی و ریه افزایش می یابد و مرگ برنامه ریزی شده سلول های عضله صاف دیواره عروق عامل اصلی تغییر وضعیت عروق خونی است و تعادل بین آپوپتوزیس و تقسیم سلولی میزان رشد سلول های عضله صاف دیواره عروق را تعیین می .]در تحقیق حاضر، 5 کند [ RT مطالعه انجام گرفته توسط - نیمه کمی بر PCR در قلب و ریه طیور (caspase1)روی بیان ژنی گوشتی حاکی از آن است که این میزان بیان ژن در T گروهی که هورمون دریافت نموده و به سندرم 3 هایپرتانسیون ریوی مبتلا شده اند به طور معنی داری نسبت به گروه شاهد و درمانی افزایش یافته است که همسو با سایر تحقیقات مشابه می باشد. با توجه به اینکه رادیکال های آزاد در بروز هایپرتانسیون ریوی موثرند و همچنین ثابت شده است که هیپوکسی موجب افزایش رادیکال های آزاد در میتوکندری ها می به C شود ویتامین عنوان یکی از مهمترین
آنتی اکسیدان ها در حذف رادیکال های آزاد تاثیرگذار ]. معمولا این ویتامین به جیره طیور اضافه 13است [ می گردد. اگر چه طیور توانایی ساختن این ویتامین را در بدن خود دارند اما در شرایط خاص مثل سرعت بالای رشد، گرما، سرما و عفونت نیاز به این ویتامین افزایش می یابد و اضافه کردن کردن آن در جیره ضروری به نظر می رسد. ثابت شده است که ویتامین می C تواند موجب آزاد شدن بیشتر نیتریت اکساید (گشاد کننده عروق) از دیواره عروق شود که این اثر می تواند در کاهش هایپرتانسیون ریوی موثر باشد. مطالعات اولیه ای که در مورد اسید اسکوربیک انجام گرفت مشخص گردید که این ویتامین می تواند مرگ و میر ناشی از استرس های محیطی را کاهش دهد ]. آنچه که این تحقیق نشان می22و21[ دهد آن است توانست میزان هایپرتانسیون ریوی را Cکه ویتامین کاهش دهد که با نتایج سایر تحقیقات مشابه نیز همسو نشان داده شده است 2است. همانطور که در جدول در گروه های درمان شده با RV/TVشاخص قلبی در تمام سنین به طور قابل توجهی کاهش Cویتامین پیدا کرده است که این می تواند حاکی از کاهش میزان پس بار قلبی (کاهش فشار خون ریوی) و در نتیجه عدم هایپرتروفی بطن راست باشد. در این مطالعه که برای اولین بار ارتباط بین میزان آپوپتوزیس و سندروم به عنوان Cهایپرتانسیون ریوی و اثر درمانی ویتامین یک آنتی اکسیدان در طیور تعیین گردید، میزان بیان در گروه درمان نسبت به گروه کنترل (caspase1)ژنی روزگی در بافت ریه و بطن راست 49 و21در سنین به طور معنی داری کاهش یافته است که این اختلاف معنی دار بیانگر کاهش میزان آپوپتوزیس در گروهی T است که با دریافت هورمون مبتلا به هایپرتانسیون 3 به عنوان یک Cریوی و در عین حال با ویتامین

در قلب وریه / زارعی و همکار caspase (1) بر میزان آپوپتوزیس از طریق اندازه گیری بیان ژن Cاثر ویتامین

12 آنتی اکسیدان درمان شده اند.

[1] Baghbanzadeh A., Decuypere E. 2008, Ascites syndrome in broilers: physiological and nutritional perspectives.Avian Pathology, 37: 117–126.

[2] Balog J.M. 2003, Ascites syndrome (pulmonary hypertension syndrome) in broiler chickens: are we seeing the light at the end of the tunnel?.Avian and Poultry Biology Reviews, 14: 99–126.

[3] Chomezynski p., saachi N. 1987, Single – step method of RNA isolation by acid guanidium thiocynate – phenol – cholorofrom extraction. Anal. Bioche, 162-126.

[4] Condorelli G., Morisco C., Stassi G., Notte A., Farina F., Sgaramella G., deRienzo A., Roncarati R., Trimarco B., Lembo G. 1999, Increased cardiomyocyteapoptosis and changes in proapoptotic and antiapoptoticgenes bax andbcl-2 during left ventricular adaptations to chronic pressure overload inthe rat. Circulation, 99: 3071–3078.

[5] Emin G., Xiao Sh. 2006,The key role of apoptosis in the pathogenesis and treatment of pulmonary. Eur J Cardiothorac Surg, 30:49950.

[6] Fazio S., Palmieri EA., Lombardi G., Biondi B. 2004, Effects of thyroid hormone on the cardiovascular system. Recent Prog Horm Res, 59: 31–50.

[7] Freude B., Masters TN., Robicsek F., Fokin A., Kostin S., Zimmermann R., Ullmann C., Lorenz-Meyer S., Schaper J. 2000, Apoptosis is initiated by myocardial ischemia and executed during reperfusion. J Mol Cell Cardiol, 32:197– 208.

[8] Gurbanov E., Shiliang X. 2006, The key role of apoptosis in the pathogenesis and treatment of pulmonary hypertension. Eur J Cardio-Thoracic Surg, 30: 499–507.

[9] Hassanpour H., Afzali A., Fatemi Tabatabaie R., Torabi M., Alavi A. 2016, Cardiac reninangiotensin system (gene expression) and plasma angiotensin II in chickens with T3induced pulmonary hypertension. British Poultry Science, 57(4): 444–450.

[10] Hassanpour H., Momtaz H., Shahgholian L., Bagheri R., Sarfaraz S., Heydaripoor B. 2011, Geneexpressionof endothelin-1 and its receptors in the heart of broiler chickens with T3-induced pulmonary hypertension. Research in Veterinary Science, 91: 370–375.

[11] Hassanpour H., Teshfam M., Momtaz H., Zarei H., Bahadoran SH. 2014, Caspase-1, -2, and -3 gene expression is enhanced in the heart and
lung of chickens with pulmonary hypertension (ascites). Turk J Vet Anim Sci, 38: 133-137.

[12] Hochhauser E., Kivity S., Offen D., Maulik N., Otani H., Barhum Y., Pannet H., Shneyvays V., Shainberg A., Goldshtaub V., Tobar A., Vidne BA. 2003, Bax ablation protects against myocardial ischemia-reperfusion injury in transgenic mice. Am J Physiol Heart Circ Physiol,284: 2351–9.

[13] Isabella D.D., Ranieri R., Roberto C., Daniela G., Aldo M. 2006, Biomarkers of Oxidative Damage in Human Disease. American Association for Clinical Chemistry, 52:4601– 623.

[14] Rai N.K., Tripathi K., Sharma D., Shukla V.K. 2005, Apoptosis: a basic physiologic process in wound healing. Int J Low Extrem Wounds, 4: 138–44.

[15] Riley DJ., Thakker-Varia S., Wilson FJ., Poiani GJ., Tozzi CA. 2000, Role of proteolysis and apoptosis in regression of pulmonary vascular remodeling. Physiol Res, 49: 577–585.

[16] Sundaresan N. R., Saxena V. K., Sastry K. V. H., Anish D., Marcus M. D. C. 2008, Kantaraja Caspase-mediated apoptosis in chicken postovulatory follicle regression. Vet Res Commun, 32: 13–19.

[17] Upadhyay G. R., Singh A., Kumar S., Kumar A. 2004, Severe hyperthyroidism induces mitochondria mediated apoptosis in rat liver. Hepatology, 39: 1120-1130.

[18] Wang Y. Y., Jiao B., Guo W. G., Che H. L., Yu Z. B. 2010, Excessive thyroxine enhances susceptibility to apoptosis and decreases contractility of cardiomyocytes. Mol. Cell. Endocrinol, 320: 67-75.

[19] Wideman RF. 2001, Pathophysiology of heart/lung disorders: pulmonary hypertension syndrome in broiler chickens. World’s Poult Sci J, 57: 289–307.

[20] Wideman RF., Rhoads DD., Erf GF., Anthony NB. 2013, Pulmonary arterial hypertension (ascites syndrome) in broilers: a review. Poult Sci, 92: 64–83.

[21] Xing R. P., Wang Y. 2002, Effect of Vitamin C On Pulmonary hypertension and Muscularisation of Pulmonary arterioles in broilers. Br. Poult. Sci, 43: 705-712.

[22] Zamanimoghaddam A. K., Hassanpour H., Mokhtari A. 2009, Oral supplementation with vitamin C improves intestinal mucosa morphology in the pulmonary hypertensive broiler chicken. British poultry science, 50:175180.

[23] Zimmermann KC., Bonzon C., Green DR. 2001,The machinery of programmed cell death. Pharmacol Ther, 92: 57–70.